

>tg1141 Archaeosine tRNA-guanine transglycosylase (ArcTGT)

>tg1141 Archaeosine tRNA-guanine transglycosylase (ArcTGT)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1082363 - 1085117 (Additional range around tg1141 is :500nt.)

>Thermococcus gammatolerans EJ3 TCGCAGGATAAAGTGTCTAAAGAACCTCGAACTCACCCAGAAGTGGCTCGTCTTCCTCGCCTCTGCCTTCTCGGCCTTCA ACCTCGGCACGAACGAGGTCTCGAACGTTATAGGCCTTGCAAAGGCCGGCGGAATGTCCGACCCAAACGCCTTCCTCGCC CTTGTGATGGCCTTCGGGACGCTCACCTTCAGCTATGAAGTCATGATGACGATAGGAAAGGACATAGCACCCCTCGGTCC GACTTCGGCATTTTCGAGTCAGTTCGGGGCCTCGATAGCGGTCAGCACCGCAAACCTCTTCGGCCTGCCCGTCAGCTCGG GCCAGGCGATAGTTGGGGCGATAAGCGGGCTGAGCGCCTACAAGGGCGAGCACGTGAACAAAAAGCTCCTCGTGGACATC GTGAAGAGCTGGGTTCGCGCGCCGCTCTTCGCCGGAATCCTCGCGTTTCTTCTCGTCAAGCTCTTCTCGGCAGGCTTTTA AGGTCGAAGTGTTAGGCCC ttgagaggtgagagcatggagttcaggttcgaggttaaggcgcgcgacgcggccggaaga atagggaagctcaccgttaacggcaagagcatcgagacaccagcgataatgcccgtcattaacccgaaacagctcatcgt aacgccgaaggagctcgaggagatgggctttggaatgataatcacaaactcctacatcatctacaagacgccggaattga aggaaaaggcccttgagctgggcattcacaggctccttgactacgacgggataatcgaggtagattccggctcattccag ctcatgcgctacggcgaggtcgaggttaccaacagggagataatcgagttccaggagaaaatcggcgtcgatataggcac cttcctcgacattccgacccctcccgacgcgccgagggagaaggccgaggaagacctcaggataaccctcgagcgggcga aggaagccgaaagcataaagaacatcgctatgaacgctgctgtccagggttcaacttatccggacttaagaacccacgcc gctcaggagctcagcaagatgaactttgaaatccacccgatcggtgcagtcgttccgctcatggagagctaccgctaccg cgatttagtggacgttgtggtggcttccaagctcggtctaagaccggacaggccggttcacctctttggagcgggccacc cgatgattttcgccttagccgttgctatgggcgttgacctcttcgactcggcgagctatgccttgtacgctaaagacgac cgctatttgacgcccgaggggacgaaaaggctcgaagagcttgagtacttcccctgctcctgtcccgtgtgctcccgcta caccccgcaagagttgcgtgagatgccgaaggaagaaaggacgaggcttttggccatccacaacctctgggtgatacgcg aggagctcaatagggtcaagcaggcgataaaggagggtgaactctggcgcctcgttgacgagagggcaaggagccacccg aagctttactcagcttacaagaggctgcttgagtaccgagactaccttgagaagaacgagccgataaccaaggcgagtgc cttcttcaaggtgagcgaggaagcaatgagatggcccatcgtttaccgcgccaaggagagggccgagcgggtggccaaaa agttccccgagaggattagacacccgatattcggagagattccaaagtatctgagtttgagctaccccttcgcccagagc gagggcgaggaggacttcacgatagagaagccgaggaaaggggaagcgagaaagtacgtcatggccgtcgcggagtacca gttcggcgaaggggcgggcgaggccttcaaggacgctttcgtggagctctcgcggaagactggcatgccgaggcaggtaa aggcgaagggcaagcacctcgcgaccttcagggcggaggacggcctgttaacgctcggcatcgagggggcaaagagactt cacgcgctcctgccgttcccgaagatgcgcgtcgtggtcaacgaagatgccgaacccttcgcgaagcgcggaaaaaacgt cttcgccaagttcgtggtcgatgccgacccctcaatcaggccctacgacgaagttttggtagtgaacgaaaaggatgaac tcctcgcgacagggcagacccttctgaacggcgaggagctgaaggtcttccagagcggactggccgtgaaggttaggagg ggaatagagaagggt TAAACAACCTTCCAGAGCTCGTCGCTGAGCGGTCTGGGGAGCGGTACTTCGTCTCCTCCCTTTA TCATGATTCTCTTTTTCTCGGCGAGAAATTCCCCGATGATAGCTGCGTTTATGCCCCTAGCCAGGAGTTTCTCGACGACG AACCTCGCGTTGTCCCTAGGAACCGCCGCCAGCAGGGAGCCCGAGCTTATCAGGGCCAGGGGATTGAGGCCATAGAAGTT GCATATCCGTTCAGTTTCCTCCCTGATGGGTATCCTCTCGACGAAGATTCTGAGCCCCAGCCCGGAGGCATCGGCCATCT CGTGGAGACCGTTGAGTACTCCCCCTTCAGTCGGATCGTGCATGGCGTTTGCGAAGTCCCTCAGGAGCATTGCCTCAGGG ACAACGCTTAGGTACTCGATCAGGCTCTTGGCCCTTTCAACGAGGGAGTCACCGAAAACTCCCCTGAGTTCCTCCTCCCT TTCGCTCGCTATTATTGCCGTTCCCTCGAGACCGGC