

>tg1149 Phenylalanyl-tRNA synthetase, alpha subunit (pheS)

>tg1149 Phenylalanyl-tRNA synthetase, alpha subunit (pheS)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1090797 - 1093293 (Additional range around tg1149 is :500nt.)

>Thermococcus gammatolerans EJ3 CTCGCCAAAAAGGTTGGAGCAGACTACGTCGTCAACCCCTTCGAGGAAGACCCAGTCGAGGTCGTCATGAGCATAACCGA CGGTGCTGGTGTCGAGGTCTTCCTGGAGTTCAGCGGCGCTCCCAAGGCCCTTGAGCAGGGCCTTAAGGCGACGACTCCAG GGGGGAGGGTCTCGCTTCTCGGCCTCTTCCCACGCGATGTCACGCTCGACTTCAACAACCTCATAATCTTCAAGGCCCTG GAAATCCACGGCATCACCGGAAGACACCTCTGGGAGACCTGGTACACCGTCTCAAGTCTCATCCAGAGCGGGAAGCTCAA CCTCGACCCGATTATCACCCACAGGTACAAGGGCTTCGACAAGTATGAGGAAGCTTTCGAGCTCATGCGCGCTGGCAAGA CCGGTAAGGTCGTCTTCTTCCCGAAGGAGTGATTTTTCTTCCTTTTCTTCCACCGCAATTCTTAAGTAAACCCTTCCTCA TTTCAAGCGGAGGTGTCGGA atggagctgagctatcaggagaagctcacccttatcaagcttaacgaactgaaaagggc taaatttgaggagctcgttaaagctactggactcgagcaggtagcggtcatgagggctgtcctcggcctgcaggcgaagg gcctggcgaaactccacgagaggagcgagaaagtcgttaagctcaccgagacgggaaagaaatacgctgaaatcggcctc cccgagtggagggccctaaagctcctccgcgagaggggaaaggttacgctcgacgacctcagagaagtcctcagcgacga cgagcttaaaccgatagtcggcctcctcaggaaggagggctgggcaagcgttaggaaggaggacggcaagctaatcctcg aaataaccgagaaggggcttgaagctgaggagaggcccattgacagggccctaaaactcctcgccgagaaaaacgttgtc ccagtcaaggaaattgagaagctcattcctgtcaaggagctcaagaggaggaaaatcggggaggaggaaaccgtaaccga gagaaccgtcgagattacaccggcaggcgaggagctggctccgaaggtagagctaaagagggaagtttccgtcctaacgc cggaactcataaagtcaggcaaatggcgcgaggtagagttcagacgctttgatataaaggcccccgtgaggaggatttac ccgggcaagaagcagccgtaccgcgctttcctcgacaagataaggagaaggctcatcgagatgggcttcatcgagatgac ggtcgattcactcatcgagactcagttctggaacttcgacgccctcttccagccccagaaccacccggcgagggagtgga cggacacctatcagctcaagtacccgaagagcggattcctgccagaggaggagctcgttgagagggttaagaccgcccac gagcgcggtttggcaggctcgcgcggctggggctatgtctggtctccagagagagccatgctcctcatgccgagggcaca cggcactgctctaagcggtagacagctcgccaagggcgtcgaaatcccagggaagtacttcacaatccagcgcgttttca gaccggacgtcctcgacaggacgcacctcatcgagttcaaccagattgacggctttgtagttggagaagagctcaacttc aggcacctcctcggaatcctgaagcgcttcgcggtggaaatcgctggagcgaagaaagtcaagttcctgcccgactacta tccgttcaccgagccgagcgtccagatgagcgcctaccaccctgaactcggctgggtcgagttcggcggtgccggaatct tccgcgaggagatgaccaaagctctgggcatagaggtcccggtcatcgcgtggggaatcggaatcgacaggttagctatg ttcaagctcgggatagacgacatccgctacctcttcagctacgacctccgctggctgagggaagcgaagctggtgtgg T GATGGGAGATGCCAAAGTTCGACGTGTCAAAGCGGGATTTGGAGAGGCTCGTTGGCAAAGAATTCACTGTCGAGGAGTGG GAAGACCTCTTCCTCTACGCCAAATGCGAGCTCGACGACGTCTGGGAGGAGAACGGTGAAATCTACTTCAAAGCGGACTC CAAGGACACCAACAGGCCCGACCTCTGGAGCGCCGAGGGCATAGCAAGGCAGATACGCTGGGCGCTCGGCTTCAGGAGGG GCCTGCCAGAATACGAGGTCGAGAAAAGCGACGTTACCGTTTACGTTGACGAGAAGCTGAAAGACATCCGCCCCTACGGT GTTTACGCAATCGTTGAATGCCTCAAGCTTGACGAAGAGGCTCTCAAGCAGATGATTAACCTCCAGGAGAAGGTCGCTCT GACCTTCGGGAGGAGAAGGAGAGAGGTTGCCATCGGTATCTTCGACTTCGACAAGGTGAAGCCCCCAATATACTACCGTG CGGCAGAGAAAACCGAGA