

>tg1167 Hef, Helicase-associated endonuclease for fork-structured DNA (Hef)

>tg1167 Hef, Helicase-associated endonuclease for fork-structured DNA (Hef)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1107230 - 1110632 (Additional range around tg1167 is :500nt.)

>Thermococcus gammatolerans EJ3 TGTGCACATGCACATGTACCTACATATGTATGTTCTGACTAACAAAAAAAGTATTTAAGGATTCAAAGGAAAAACCGAGC GATGAAGGCACGAACCTACCTGCTCCTCTTCATACTGCTCGCACTCGTTGATGCGCTCACAACGTGGTTTGGGGTTAGAA TGGGCTTTGTCGAAGCCAACGGAGTAATAGCTGAAAGGCTCGGGAGCCCCACGCTCTTCTTCGGCAGCTACGCCTTCTTC ACGGCACTCGGCGCGGGGGTTATAGCCGTTTCAATCAAGCTGGAAAAGCTCAACCCGGCCTTCAAGCTCGTGGCTGTTGG AATGGTAGTTCTCAAGGCGATTCCCGCGGTGAACAACGTTCTCCTCCTTGCTGGCATCTCAAAGTCAAGCGTCTTTCTCA CGACAGTCGAGCCGCTGTTGAAACTGGCCTCAGGGTGACAATCTGAATTGCCAATACTGGCTCGGAAAGCTTTTATGGTT CCCCGCCGAAGGGCCCAAT atgtcctatctccgccgcgatttaatcgagccccgcgtttaccaggaggttatctacgcc cgctgtaaggagcggaactgcctcgtcgtcctgccgacgggcttaggaaagacgctcatagcgatgctcatagccgacta caggctctcgaagtacgggggaaaagtcctcttcttggctccgaccaaaccgctggcgatgcagcacgcggagagcttca ggcgactcttcaaccttccgcccgagaagattaacgtcctcaccggtgagctttccccggagaagcgcgccgagctctgg aggaagagcgtggtagtaaccgcgacgccccagacggttgaaaacgacattctgactggcaggatttcgcttgaggatgt cgtcctgctcgttgttgatgaggcccacagagcggtgggtaactacgcctacgtcttcatagcgagggagtacctcaaaa ctgcaaagcacccgctcgttctcggcctgacggcctcgccgggcagtgacgaggagaagatacgcgagatagttgagaac ctcgggatagagcgcatcgaggttagaacagagagctcacccgatgttaagccttacgtccatagaatagccttcgagtg ggttagggttgagctccccggaatctacagggaggttcgaaaaatcctgcgcgagatgctgaaggattcgttaaagcccc tcgccgatgcaggcttggtcagttctccctcgcccgatatctcgaaaaaggaagtcctacaagcgggctcgaagataaac caggcgatggccaagggggactactccgccggctacctcaagaagcaccaggccaaggccatgaagctccaccacgcgat tgaactcctcgaaacgcaggggctaactgcactcaggaactacctcaagaagctccgcgaggaccgctccaagtcaagca gagagcttatggaagacccgcgtatgaggaaggtcatctacctactcgtccaggcgaaggagctcggcctcgaccatcca aagatggaaaagctgaaggacctcatcaaaaaacagcttgagcggaagcccgactcaaagataatcgtttttacaaacta ccgtgacaccggtaaaaagatagtcgaggagctcagaaacctaggggtttcggcggagcgcttcatagggcaggcgagca ggggaacggataggggaatgagtcaaaaggagcagaaagaagttttagataggttctcgcgcggtgagttcaacgttctg gttgccacgagcgtcggggaggaaggtttggacgttccggaggttgatttggtcgtcttctacgagcccgtgccgtctgc aataaggagcatacagcgccgtggaagaacaggtcgtcacaggcccggaaaagtggtaattctcatggctaagggaacgc gcgacgaggcctactactggagctcccggaggaaggaaaagggcatgtttgatgcaataaagcgcgtggcaagggaactc gaaaaggcccagcaaaagcgtggtaaaataagggaaaggaccaaggagcgtgttgagatgccctcaaggagtaagataac ctccctcgatgcgttcctgaaggttgggaaagccaagaaagccggaggcgaagttaaggagaccaaagaatcggagaaaa agaacgaatcgcagacaccgcagattcaagagaagagaacagcggagaacagggacaaggaaatccccattaagccaatc tttgtgaagaagccgaaggggatagtgatttacgttgactcgcgcgagctgaggagcggagtgccgaagattctgaagga gctcggggcggagattgaggtcaaaacattagacgtcgccgattacgttgtcagcgaggaggtgggaatagagcggaaaa gcgccaacgacttcatacagtcaatcatagacggcaggctcttcgaccaggttgagaggctcaagagggcctacgagaag cccgtgataatcatcgagggcgagctctacggcatcaggaacgtccaccccaacgcgattaggggagccatagcctctgt aaccgttgactggggtgttccagtactcttctcctcggggaaggaggaaacggcccagttcatttacctcctcgccaagc gcgagcaggaggagcggaagaaggaagtaaggctgaggagcgagaagaaagccctaaccttagctgagagacagcgcctc atcgttgaaggtctccctaacgtctcttcaaccctcgccaagcgcctgctgaggcacttcggcaacgtcgaaaaggtctt caccgcaacggaggaggagctcaaagaggtcgagggcattggtgagaaaaaggcgagggagataaggaaggttatcactg ccccctatgttgaggacgaaggg TGAAGAACTATCCGGACTAAGCGGCCGTGCACTCCCAAATTAAGCTGATGCAACTT GACATCAAATAGGACTTTGTCAAAAAGGGTTGTAGCTGTGCCCCCGGGGAGCGAAGGGGAATCACAGCTCGCCGAAGCGC TCATCCCCCGCGGTTTCCCGGGGGCGGGAGAATATACACCCACGTGCTTAAATCCCTTTTCACTCGGCAAAAGTTTAATA ACTATTTAGAGTTTCTCACTACATGCGAGCCGGGGCCAAGGGAGAACTAACCTACGTGGGAGCTACCTACATAGGAAACT TCATGGATAAAGAGCTCATATTTGACATCTTCGACAGGGTAAACCGCTATTTGGTCCGGAGCGATCTTCCCGTCAGGTTT CTCTACCTCGGAAAACTCGAGGTTGGCCCCGGTTACCTCATCAACATTCCTGTGGGAGATACGCACGTCAAGGGCTATCC CCTAGAGGCCGTAATTGAGGCCCTCTATGCCCGCCTTCTCCAGG