

>tg1173 hypothetical protein TGAM_1173

>tg1173 hypothetical protein TGAM_1173

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1115441 - 1118126 (Additional range around tg1173 is :500nt.)

>Thermococcus gammatolerans EJ3 AGAAAAGGCTGGCTCGATTGAGAAGGCAAGGAAAAAGCTTGAGGAGTTAAACTCGGGGGTCAAAATCTAAGGAGAAAGCC TTTAGGCTTCCGAAAGCACCTTGAATGATAACTTTCCGATCTTTACAACTTTTCTAAGCTCCTGAACGAGCTCTTTACCA CCAATCAGTTCCATCCTGATCTCGGACATACCGGTTGCATCGGGCGGAAGGAAGTGTATGTCCTTAATCCTGCCGGAGAC CTTGGAAAGGAGGCGGCTCAGCACGCTTCCCCTTTCTCGATAGGGGAGTTTGATGTCAACTTCGAGAATTTGCATAGCCA TCACCGTTTTATTTTAAAGAAGAAGGCCTATAAAACCTTTTTCATGAGCCAAAATTATTGTTCCCCGTTAAAAATATTCT CAGCAGTTATCGAAAATCGACCGAGTGTCGTCAGTATGGCTTTTATAAAGGTTCGGAGAGAATTCATTGTGAAAAACAGC AGAAGTAAACCTATGATTA atgccagggggtggcaccatgaagaggatgttcgtcttcgtggggctcctcctcatctta gggaccctgattcctgcgggaaaggtgattgcagaagaaaacactcactgggccaaaacatacagaggggaatgtgaaga tacggctcgcgcggttgctattgctccaaacggagacattatagtcgcaggctatactgaaagcttcggagctggttatg gcgacgtttgggttctcaggctcgatagcgagggtaatgttaagtggcagaagacttacggtggaagtgacaaggattgg gctgctgcggttgcagtcgcggataacggtgacgttatagtggcaggcgggactgaaagctttggagccggtaaagctga cgtttgggttctcaggcttgacgagaacggcaacgtgaaatggcagaaaacctacggcggtaaaggttatgatgtagctc gctcggttgccattgcagaaaatggagacatcatcgtggtaggtggaactgaaagcttcggggctggtaaagctgacgtt tgggttcttcgcctagacgagaatgggaatgtcaaatggcagaagacttacggtggaagtagttatgattggggtcatgc ggttgccattacagacaacggtgacgttatagtagcaggctccacggacagcttcggtactcacgaagatgttttggttc ttaggcttgataccaatggtaacgtgaaatggcagaaaacctatggcggaattagaggtgatatagctttcgcggttgcc attgcaccgaacggggacatcatagtaacaggtcacactaaaagctttggtgattgggatagtgacgtttgggttctccg cctggatgggaatggtaacgtgaaatggcagaaaacctacggcgggagtagtgatgatgatgcttattcggttgcaattg caccaaacggggatatcatagtggtgggtcggacttggagcttcggcgctggtgaagatgacgtttgggttcttaggctt gacgagaacggtaacgtggaatggcaaaaaacatacggcgggagtgacgaggaggaggcttatgcagttgccgttgcacc aaacggggatatcatagtggcaggctggaactttggcgctgatcttgctgacgtttgggttctcaggctccccccagatg gttcactctcaaacttgccgagagactccaatgcccctgttggagatacgactgttcaacccggtgatttcaatgcaagt gttaaagattcccaagcgcaggtgatggattcgcaagcggtagtacaagactctgacgctactgtcacgacagtgatgag ttcggaaacaacttcctcaactaccactacgacgtccccaagccaaataactacaaccactaccataacagccactcaca ggacaactacgactaccacccaccaaacaacgacaacccacgaaaccaccacgacgagcaaaccgactacaacgagcagc aagactaccacaacccccacaacctccacagccccaatccacaccggaactacaacccacaagactacaacaaccacaac gacttctgagggcggtggaggcacccatatctgcggtccagcaacaatagtcggtctcgtggttattaccgcggccgtaa gcaaaatccggcgcagaaaacaccag TAAAGGCCATGTTGCTCCAATTAATTTCTTTCCCTCGTCTTCTTGCTTTTAAA CTACTTAAGAGGTGGATTTTAGGTGGATGCCCAATGGCGTTCATATTTGAAGAAAAGTGCTGGGTGAAGTTTATATATCA TCTTTCCATTTTTCCAGTTAGGTGTCGAGTATGCCATACATAGAGAAGATTGAAATGAAAGGCTTCAAATCTTACGGTAA CAGGAAGGTTGTCGTTCCACTTTCCAAGGGGTTCACCGCCATCGTCGGTGCCAACGGTTCTGGAAAGAGCAACATCGGTG ATGCGGTTCTCTTCGTTCTGGGGGGCCTCTCTGCCAAGGCAATGAGGGCAACGAGGATAAGTGACCTGATCTTTGCAGGA AACAGGGCTGAACCACCTGCGAAGTACGCCGAAGTGGCGATGTACTTCAACAACGAGGACCGGGGCTTTCCAATCGATGA GGACGAGGTCGTGATAAAGAGGAGGGTTTACCCAGACGGCAGGAGCA