

>tg1210 Rubrerythrin-related protein (Rr)

>tg1210 Rubrerythrin-related protein (Rr)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1143068 - 1145048 (Additional range around tg1210 is :500nt.)

>Thermococcus gammatolerans EJ3 TCGATTGCCTCGAAGACTTCCTTCTCGGCGTCCCTCGCGTGCAGAACAACGGGGAGCTCGAGCTCAACTGCTAAGCCCAG AAAGTGGGCGAAGATTTCCCTCTGGTTCCTCCTCTCGGCCTCTGTCCTCGCGTAGTAAAAGTCCAGCCCGATCTCGCCGA TTGCCACGATCTCGCCGGCGTGCTCCCGTATAAACTCCTCAACCCGTTTCACTTTCTCCCAGTTTCCCCTCCTCGCCTCG TTCGGTGCGTAGCCGAGGGTTGGCTGAATGAAACCGAAGTATGGCTTTAAAGCGTCCCAGCTTTTCCAGACGTGGAACTT CCGATACTCCGTTATGGAGTCGACTATGAGCTTCAGCCTTTTCCGGCTCTCCTCAACGACCTCTGGAATCTTCCCCTTGA ACATCTCAACGTGAGCATGAGCGTCGATCATCACCATCCCCATCGAAGGTTCGCCATCCATAGAAAAGCTTTTCTTCAAT ACGGAAGATTAAGAAAACG gtgaaggcattggtaagctttaatagggagagactggagagttatctcagtgaggttgtc gataagctgaaatcgctctccttcaaggaggccctgagctacgcgatcttcaacgaagaggacgaggcaaaatattacgc agagctggcccagaaagccaaaaggccaagcgttagggcgctctttctccagatgagtgatgagagccttgggcacaaag aaaggctttacaagctcttcaaaaagctctttcccgacgaggagccggttaaggtagatgctccccccgtagaggttgcg cccttctatcctgagtttgaaaaggttgaagactacctccacgcccttgagtattgcatggagagtgaactctttgcgaa gaggacctacgagatactctcgaccaaagcagaggacgaggaggccagggctttattcgcacagctcgcactcatggagg aggagcactacgaaagaataaggaaggtctacgaactcgtctcaaagatgaagaggaggaaaatatccttggaagccctg gaaccagggggttacctttttgaggacagggcgaaggcacgctacacattcctcgacgtaatcggagaagatagggggct tgtgataacacgggagcacccgaagaagatccgctcgtggatgaaaattgacgtcccagttctctggctctctgagagtg caatgaagatgagcggtgtcagaaccctcccccccaagctcctccttgacaaggcagaagacatagccgaatgtgtctcg tcggaaaatctcagagccgtcctccttgaaagcgccgagtacttactcttggaaacaactgagaaagacctgataaagtt cctccttgatttgagggatctggcgatagagaggggtttttaccttatagtctccgcagaaaaggaagcgtttacaccca cgagctgggccatattgagggccaacatggaaaggatagag TGACTATTGCTTCCGCCTTCTTTTCTCCCACACCACCT TTCCGTTCCCCTTCACGACTCTGATGATGCGGTGATAGGGAATCTGTGTTTCTCCAATGAAGAAGTAGCCGTGTCCAAGC TCGATCATCTCGACCGGGATCTTCTTCTCGTTACCGTAAGCTCCCCGGTGCTCGATAACGATGTAGTAGTCCCGCTCATC CTCCCGGGGGTCGTGCTTGATCTTCGCCAGAACCTCCTTTAGAGAGCCCTTCCTCATCATACCAGCCCCAGGACTTTTTC CAAGTTCCTCCTCCACTCGGTTATTGGCCTTCCATGACCCGGCAGGCCGAAGTCCACTTCAAACTCGAGAAGCCGCTCAA GGCTCTCCCTGAGCTCCCATCCGTTCCCGGTTGGAAGGTCAACCCTTCCGACCGTTCCGTTAAAGACGGTATCGCCCGTG AACATTATTTTGGTATTCCCTTCCTCAAGGTAGAGGCAGGCACTCCCTGCCGTGTGACCCGG