

>tg1232 Cytochrome bd ubiquinol oxidase, subunit II (cydB)

>tg1232 Cytochrome bd ubiquinol oxidase, subunit II (cydB)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1159980 - 1161972 (Additional range around tg1232 is :500nt.)

>Thermococcus gammatolerans EJ3 CTCACGGCGTTGACCCCAACGCCCCGGACGCCAACGAGCAGATGGTCAAGGTTCTTGAGGAAGCCCTGCCGGTGGCCTTC ATGTTCTACGCCTACCGCGTCATGATAGGCCTCGGAACGCTCTTCATACTGATAGGACTCATTGGAGTGCTCCTCCTCCT GCTCGGCAAGCTCTACGACGCCAGGTGGTTCCTAAAGGTGCTGGTCGTTACCGTCCCGCTCCCCTGGCTCGCCAGTGAGG CCGGCTGGTTCACCCACGAGGTCGGTAGGATGCCCTGGATGGTCTGGGGCATGGTAACAACCAACACGGGAGTTTCACCG AACGTCTCGGCGACCCACGTGCTGATAACCCTCATAGGCTTCGTCGTGGTCTACAGCGTGCTGTTCTACATCTGGCTCCA CTTCGTCAGGAAGCTCATCAGGGAGGGTCCCGAGCCCGTTGAGGGTGACGTCACCGCGAAGCCGACCCCTGCCGTTAGCG TCGCGGGAGGTGGTCAGTG atggactacgcgactgcctggttttacttttccgccttcctcctcggaatgtacctggcc tttgatggctttgacctcggtataggtgcactgcttgccctcatcaagaaccagaaggacagggacatcctcatcaacac catcggccctgtctgggacggcaacgaggtctggttcatcacctggggagcggggctcttcgccatgtggcccgccctgt acgcaacgctcttcagcaccttctacctcgcaatatggctcctggcgttcctcctgatattcagagccgtcggcttcgag ttcaggaacaagaacaaggaactctgggacaagctcttcgccctcgtcagcgcgctgataccgctcgttgtcggagtcgt cgtcggcaacctcgtcatgggaattcccatagacgccaatggcttccacggctcactgcttacgctcttcaggccatacc cgctcatcgtcggtctcttcatactcttcgccacaatatggcacggtgccaactggggcgtctacaagaccaccggaaag cttcaggaggagctcaggggctacgccttcaagttctggctcctgacggtggtcttactgctcctgactgtaatcggcat gaaaatctgggccccgctgaggttcgagaggctcatgactccacttggccttggactgacgctggtaatcctcgtggctg gactgctcgacggccacctcatcaagaagggcgaggagaggctggcgttctacataagctggctggccttcccgctcgtg gtgttcctcgtttactacagcatgtacccctactgggtcatctcgaccaccgacccgaacttcaagctcagcatacacga cctcgcggcgtcaccgctgaccctcaaggccgtcctcggagtctcagtaatcctggcggtaatcatcatggcctacaccc tctacgtctacaagatgttcggcgggaaggtcaccgaggccgagggctactac TGAGTTTTCTTTTCCTTTTTTCAAGT GTCAAAATGAACGGGGAGCAATTCTAAGGAGGTTAAGTTAAATAAAGTCTAAGGCTGGAGAGATTGTGAGGGTTCTCCCG GAGGTGCTCCCATGAGAGACATGCGCGACTATCTGGAATGGCTTGAGGCGAGAAACGAGCTGATTAGGGTTGAGGAAGAA CTCTCGCCCGAGCTTGAGATTCCCGCGTTTCTGAGGAGAGTGATGTACGATAAGGCTGGAGCCGTTCTCTTCGAGCGCGT TAAGGGCCATCCAGAGTGGAGAGTAGCGGGAAACCTCTTCACGAGCGTCGAGACAGTTAGGGAAGCCCTCGGCGTTGAAA GGCTTGAGGAAATCGGCGAGAGACCGCTCAAGCTAATGGAAAGTTTGCCCCTTGGATTATCCGACAAGCTGTCGTCGCTG GGGAAGCTCAGGGAGCTGGGCAACTATCTGCCTAAGCTCGTGAGGAAAGCCGAGTTCACGAGAAATGTGGTGGA