

>tg1233 Cytochrome bd ubiquinol oxidase, subunit I (cydA)

>tg1233 Cytochrome bd ubiquinol oxidase, subunit I (cydA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1160975 - 1163483 (Additional range around tg1233 is :500nt.)

>Thermococcus gammatolerans EJ3 GGTGCCCCCTCCGAGAACCAACACCTTGGCCATACCCGCACCTCCAGTACTCCTACTTTGATGTTTGTCCGAATGAGTAT ATAACTCTTTCGATTATCGCACCGTTTGAGTTCGGAAAAAGACTCGTCCGAAAGAGATATAAGAATAAATTGTTCTAAAT ACAGTTTGAGGTGGTCGTATGTCCGCGCAGATCGAGACTAATCGAGAGGTCGTTGCGGGTCTTGTAGCAATAGTACTTGC ACTGGCTTTCGTACTGATAGCGTTTCTGCTCCACAACGTTGTCTGGGTAGTGCCGGGGATGCTCTTCGGAATAGGCTACA TGATCTGGGTCTTCCACAGGCACGGGATGCCCTCCGCCAACAGTCCGAAGGCAAAAGTTTAGCTTTCTTTTTCCAAAATT TTCATCTGTGTGATGACCACCCTTAGTATAGGTTCCGAAAACATTATAAGTTTGAGTATCGGTAAATTTAGTTTGAAGGA TAAACTGAGGTGAGCGGTT atggacccgatactgctgtcgagaatacagttcgccctgaccgcgggctaccactggatt ttcgtgcccgcgagcataggaatggccttcatggtcttcctgctctggaccatggcggccataaccaacgagaagcagtg gcacaaggcggcgaagttcttcagcaagtggcttgggatattcttcgtcctcggtgtcccgacgggaatagtcatggagt tcgagttcggagcgaactggtcgcagtactcagtgttcgtcggctcgatcttcggtcctccactgatgctcgagggtctc ttcgccttcgcgctggagtcaacgttcctcggcgtgcttctcttcggcatggacaggcttccgagggcgataacatggat ttcatcgttcttcgtgttcatcggttcgagcctctctggcctgtggattctcatcgcaaacagctggcagcagaccccaa caggctacataatccagaacggcagggccgagctcaccgacttcatgggggcggtcttcaacccgctccttgtgagccag tacacccacacaatcaactccgccatactcaccggggcctacatagtcgcagccgtcggtgcctactacctcctcaagaa gaggcacgtccaggtcgcccgctcggcagttgcaataggtgtggtcgtcctcgcgataagcgcggtaatacagctctacc caacgggccacgcggagggccaggtcatcgccaagtaccagccgaccaagctcgccgccgacgagggactcttcaagaca gagaagggtgcacccatgataatatttggaatagttgacgagaagaaccaggaggttaaagccgccatagggattccaaa gctcctcagctggctctcgttcggtgactggaacgccgaagttatgggactccacgacgcggccagatacgtctggtacg agcaggttctcaacaacccgaacttcgccagcgagaaggacaggaaggagttcatcgagaccctcatgaaggctcacggc gttgaccccaacgccccggacgccaacgagcagatggtcaaggttcttgaggaagccctgccggtggccttcatgttcta cgcctaccgcgtcatgataggcctcggaacgctcttcatactgataggactcattggagtgctcctcctcctgctcggca agctctacgacgccaggtggttcctaaaggtgctggtcgttaccgtcccgctcccctggctcgccagtgaggccggctgg ttcacccacgaggtcggtaggatgccctggatggtctggggcatggtaacaaccaacacgggagtttcaccgaacgtctc ggcgacccacgtgctgataaccctcataggcttcgtcgtggtctacagcgtgctgttctacatctggctccacttcgtca ggaagctcatcagggagggtcccgagcccgttgagggtgacgtcaccgcgaagccgacccctgccgttagcgtcgcggga ggtggtcag TGATGGACTACGCGACTGCCTGGTTTTACTTTTCCGCCTTCCTCCTCGGAATGTACCTGGCCTTTGATGG CTTTGACCTCGGTATAGGTGCACTGCTTGCCCTCATCAAGAACCAGAAGGACAGGGACATCCTCATCAACACCATCGGCC CTGTCTGGGACGGCAACGAGGTCTGGTTCATCACCTGGGGAGCGGGGCTCTTCGCCATGTGGCCCGCCCTGTACGCAACG CTCTTCAGCACCTTCTACCTCGCAATATGGCTCCTGGCGTTCCTCCTGATATTCAGAGCCGTCGGCTTCGAGTTCAGGAA CAAGAACAAGGAACTCTGGGACAAGCTCTTCGCCCTCGTCAGCGCGCTGATACCGCTCGTTGTCGGAGTCGTCGTCGGCA ACCTCGTCATGGGAATTCCCATAGACGCCAATGGCTTCCACGGCTCACTGCTTACGCTCTTCAGGCCATACCCGCTCATC GTCGGTCTCTTCATACTCTTCGCCACAATA