

>tg1235 FAD-dependent pyridine nucleotide-disulphide oxidoreductase

>tg1235 FAD-dependent pyridine nucleotide-disulphide oxidoreductase

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1162950 - 1165095 (Additional range around tg1235 is :500nt.)

>Thermococcus gammatolerans EJ3 CGAACTGTATTCTCGACAGCAGTATCGGGTCCATAACCGCTCACCTCAGTTTATCCTTCAAACTAAATTTACCGATACTC AAACTTATAATGTTTTCGGAACCTATACTAAGGGTGGTCATCACACAGATGAAAATTTTGGAAAAAGAAAGCTAAACTTT TGCCTTCGGACTGTTGGCGGAGGGCATCCCGTGCCTGTGGAAGACCCAGATCATGTAGCCTATTCCGAAGAGCATCCCCG GCACTACCCAGACAACGTTGTGGAGCAGAAACGCTATCAGTACGAAAGCCAGTGCAAGTACTATTGCTACAAGACCCGCA ACGACCTCTCGATTAGTCTCGATCTGCGCGGACATACGACCACCTCAAACTGTATTTAGAACAATTTATTCTTATATCTC TTTCGGACGAGTCTTTTTCCGAACTCAAACGGTGCGATAATCGAAAGAGTTATATACTCATTCGGACAAACATCAAAGTA GGAGTACTGGAGGTGCGGGT atggccaaggtgttggttctcggagggggcaccgcgggtctcattgcggcgcgctacct taaagctgaggctgacaggctgaagctcgacgttgacgtgacgatggtgaccgcgagcgagaggcactacatgccaccac tcttcatggaggtcgcgctcggctcggcagaggctcacgaaacctgggctccgataaagaacgccgagaaggtctacggt ttcagggttgacatcgatagagtaactaagattgacctcgataacagacaggtaaagaccgagggaggaaaggtttacga ctacgactacctcttcctcggcctcggcgtcaagtacgcctgggacaagtacaaaggccttgccgagcacggctaccaca actacacccttgaaggcgcactcgagctgagaaaggctctctacgggttcaaaggaaagaggatagtcatctacgccccc gaagtgccctacaggtgcggcatttatccctacgagatggggctcgcgctcagggcctacttcgaggccaagggactcaa cgacgttgagataaaggtcgttcatcccggtgacggtcccgcgaggagcctcggcccgaccgtgagcaggttcttcgaga aggagttcgagaaagccggagtggagttcatccaccacgacgggcacgagagaataaccgagggcaaacttgtaaccaaa aacctcgagctcgactacgacctactcatcaaggtcccgcccatagcgattcccgacgtcatggccttcatggccgatag ccaagacccgcgctgggccaaggttaagggtcctgacttccgctaccccggctacgatgatgtttacgtcgtcagcgagg cgagcatgccacccttagggctcttaacggctggtgtcccgctccacaacgcggcggtagtttctgcaacgagcatactc caccaggtgcatggaggctatccgatagccgaatttgtcccgacgatgtgcctcggcgtgggttatcacacgggcttcac ggccaactgcgagtataggtggacggggagcaagtacgagagaacctgctacctgctcttcaagagccccctcataaagg agatgaaggcctccttctacaggggctggcttgacagtttgaggctg TGAGGTGAGGAAGATGAGCGAGCTCAAGCTTA CCCCCGAAGAGGTTGCCGCCGTTAGGGAACTTGTCGAGGTTGCCGTAGCTCTGAAGAAGGGCGGAACCCTCGGACTGCTC AAGTCCTTCACCGAGAACGGCGACAGGTTACTCGAAACAATCTCCGAAGAGAAGGCCCTTTTGAGGCTCGCCGCGATAGG AAATTCAGCCCTCGAACCGGTCAGGGAAATTGAGGCAGAGAAGGTAAACGACATCAGCATGAACGTTGAGGAACTTGTCA ACGCCCTTCTCAGGGCCCTCGCAGAGACAAACCCGAAGGAGGTTCCAAAGGTCGGGATGACGGGAGCGATTGGCTACCTC CGCGACGAGGACGTTCAGAAGGGCCTCGGCTTCCTATTGACCCTTGCGAAGAACCTCGGTAGGGTTTTGAACGAGAAGTG ATTCTTTCCCTTCTTTTTGGAGGTGGAACCGTGAGGGTTCTCTTCACCTACATGGGAGCGCCGACGA