

>tg1261 Glycosyltransferase

>tg1261 Glycosyltransferase

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1184618 - 1186970 (Additional range around tg1261 is :500nt.)

>Thermococcus gammatolerans EJ3 TTTGTTCCCTTCAGTGTTACGGTTATCTCTGCCATCCCCTTCCTGCCCTTCTCAGAGTTTTTACTGAGGAAAGAACCTTA TTCCACAACCCTGGAGACCGTGAGAATGCTCAGGGGCGTAACCCTTACGAACCTAGCAGGTGAAATCGGGAAAACTCCCA GACGACTTAAGTTTCCTCTGGCGGTTCTCTTTCTCAAAAGGCAGATCAGCCTTATCGACCTTTCTTCCCTTGGTTTCAAT GATACTTTGGTAGTTCTCCGGGGTCTTGAGGCGGAGGGTGTTGCGGCCTGGGCAATTGAAGTTTATCCCAAGATGATGGA GAAGATAGCCAACAACCCGGGAATCGGTGTGATAGACCTCGCACGTCAGGTGAACATGCCGCCCTACGACGTTCTTCGGC TCCTTAGAGAGCTCTCACGCTATGGGGTGGTTGAGCTCAGGAAGATAGTCGTCGATTACGAGGTCTATCCGATGAGAGCT CTCCTGAGGTGGTTTGAGGC atgagacgaaaactggtgtcctacttctccgccctcgtcgttgcaagctacattgtgta cattgattacctcttcgtccaggaggccgtgtggaaagttatctcgcttctttttcagggtgtccccaggtatccggtct atgcctttgtcaggtatctcttctacttgacgggggcattcgttatcttgatatatgcagcctatttcattttctacctc cacttcagagaaaacgaggggtcaaagccaaatccccgcttttttcccaaggtctccttggtaataccggcccacaacga agccatgaacatcgagcgtctaatagagagcattcagtatcaggactatccctttgagtgttacgaggttatactcgtag acgacggtagcgttgatggcacgcccgaaatagctgagaggtatggaattagggtgatccgccacgagagaaacatggga aaagccaaagccctcgaaaccgggataaaagcggctaaaggggacgttatcataacactggacgctgattcttactttgc tgacggttcttctctgaggaacatcgtggagaacctgttcagtaggcccttcgtgggagtttccaccggggcgattagaa ttgacgtcagaagtgggaagttgatagagaagtttcaagtaatcgagtacctacactcctttgaagttgggagaagagtc caaggctaccttgactggcttctcgtagttcccggggccttttcagcctttaaaggatacctaataaaatcccttcccgc gatacctagggacacgctggccgaggactttgaacttgccatgataacgtatcgggccggactgacttcaaacttcgagc caaaggctgcagtctacacggagccagcaacttcgtggagggagctctacaggcagaggataaggtggtattacgggggt cttcaggttatggccaagtatcatgacatgataatgaacaggaaatacggggagaaggggctttttctattcttccacat gattctcttggagtacatccttccggttctgcaggtgttcggtatagtggcgttccccctcataatgctagttcataact ttctcggcctggaaatactcgacataacgctgcccttcccccttatgatggctgtctttctcctcgttcttttcctccag tatctcccgggggtcctgatgagcggcattgcaatggccattgaaagaaaccccagaacagccctcgggtatctccccgt gatatttctttactatcccatctacaacccccttctctcgctggcaaaaatagacgcaatgctgaggtttctccgggggg tggttcagtcatgg TAAAAAGGATTATACCCTTCCTTATCCTCCCCCTGCTCCTCGTTCCAGTGGCTGCAGCCACGGGA GTCGTTTATGTTGCTTCGGATCCAGGGGATGTTCCCCTGTACCATGCCCTTTCCGAGAGAATGGACGTAACCCTCTCCCA AAAACCAGAAGGGGACATCATCCTGGCCCTAGATCTAAACTACAACTTCCTCAATGAGAGCGGTAGAGAGAATCTCGTAA TGCTCCTTCGGGAAGCAAAGTCAGGTAAAACCGTTATAATAGGTTTCAACACGCTCAGGAGCCTTGAGCTTGAGGATCCG GAAGCTGTAAGGCTCCTTGGTATTTCAGTTACGTTCAGAAAGATCGGCATCATCAGAATAACCCCAAAAAATAGATTTGA GTTCACACCCTTCAATTATGATTCTGATGTCTACGGCATAGCGGAGGTAAATGCCACAGGCGGTAATGTGTTGCTGAAAG CTGAGAACCACACAATTCTTCTCGAAATACCTGT