

>tg1262 Transcription regulator, putative, HTH/Fis type

>tg1262 Transcription regulator, putative, HTH/Fis type

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1185967 - 1188124 (Additional range around tg1262 is :500nt.)

>Thermococcus gammatolerans EJ3 AACTTCGAGCCAAAGGCTGCAGTCTACACGGAGCCAGCAACTTCGTGGAGGGAGCTCTACAGGCAGAGGATAAGGTGGTA TTACGGGGGTCTTCAGGTTATGGCCAAGTATCATGACATGATAATGAACAGGAAATACGGGGAGAAGGGGCTTTTTCTAT TCTTCCACATGATTCTCTTGGAGTACATCCTTCCGGTTCTGCAGGTGTTCGGTATAGTGGCGTTCCCCCTCATAATGCTA GTTCATAACTTTCTCGGCCTGGAAATACTCGACATAACGCTGCCCTTCCCCCTTATGATGGCTGTCTTTCTCCTCGTTCT TTTCCTCCAGTATCTCCCGGGGGTCCTGATGAGCGGCATTGCAATGGCCATTGAAAGAAACCCCAGAACAGCCCTCGGGT ATCTCCCCGTGATATTTCTTTACTATCCCATCTACAACCCCCTTCTCTCGCTGGCAAAAATAGACGCAATGCTGAGGTTT CTCCGGGGGGTGGTTCAGTC atggtaaaaaggattatacccttccttatcctccccctgctcctcgttccagtggctgc agccacgggagtcgtttatgttgcttcggatccaggggatgttcccctgtaccatgccctttccgagagaatggacgtaa ccctctcccaaaaaccagaaggggacatcatcctggccctagatctaaactacaacttcctcaatgagagcggtagagag aatctcgtaatgctccttcgggaagcaaagtcaggtaaaaccgttataataggtttcaacacgctcaggagccttgagct tgaggatccggaagctgtaaggctccttggtatttcagttacgttcagaaagatcggcatcatcagaataaccccaaaaa atagatttgagttcacacccttcaattatgattctgatgtctacggcatagcggaggtaaatgccacaggcggtaatgtg ttgctgaaagctgagaaccacacaattcttctcgaaatacctgttggaaaaggtcgactcgtgatactaaccatcaaccc tgcggattattatctcaacaccaaaaaccctgcgattgttgattttctcgtggccactgtggaacactacactggagggg aatttccaactggaattgtagttggtctgggtgtcacgggggtaatggccgcctatgtcgccttctccaacaatcctcag gccgagaaaataaggaggtggataaaaactctccccctaatattcggcaggttcataactcctcccgaagacgtcctcaa gaacagcacgagggcggcaatatacaactacatcaaggccaaggggtactccacaatagatgacgttgcttcaacgtttt ccatttcgagaaccaacgcccgctggcacctcagcgttcttaaaagggctcggctcttggaggagactcccgttgggaag gtcataattttccatctccctggacagaagaaccgcagaagggctgtacgcgatttcctgcttgagaatacaacccgccg aaagatatatgatctccttcaggcgggaaaaagcttaagcgagatcgccagaatactaggggtgagcaaatccaccattc actacaacatccagatcctcaaggaatacggggtgctgggggaggaagatgaaaaggaa TAGCCTCGCCTTTGGGATAC TGCAACTATTGGGATACCTTCTCGTATTCTCCATCATGATACTCGTGATAGGGGCTAAATTCGGCGATCCGCTGGTGAAG ATGGAGGCAAAGAACATCCATGTCATGCTTAGAATCCTCCGAGTTCCGAACATCCTTCTAGGAAACATGGTATACTTACC GGAGGAAAGGCTCTCCTTCGAGATAACTTGGCAGTGTAGTGGGATGTTCAGCATAAGCTTGTACACTGTCGTTTACTTAA CCTTCCCGAGGATACGCAGGAATCTTTGGGAATGGTTCTTTGGAGTTTCAGTTCTTTACGTAGTTAACTTCTTCCGCGTC CTTACCTCCATACTCCTCTATCACCACATGGGAGAGGAGGTATTCTCACTCTTCCACTATATCCTCGGGCCCGCGATGAT GTTTGGGGTGGTTGTTCTTCTGCTGGGAGATCTCCTTGTGAAGAGCCTGAAGGAGAGACGGCAAAATTGAGTAGGAAGT