

>tg1269 Thiamine biosynthesis protein (thiC)

>tg1269 Thiamine biosynthesis protein (thiC)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1190729 - 1193006 (Additional range around tg1269 is :500nt.)

>Thermococcus gammatolerans EJ3 GCGGTTGTTTTTGAGGACCAAATCCTCAACCTCAATCATGTTGAAGAACCTTACGCCGGCCTTTACAGCCCTGCTCGCTA TCGTCGTAGCCGTCTCGATGGCGTCGGCAACGTAGAGGCCGTTCCCGAAGGGCCTGTAGTTTATCCCGAACTCGTCGAGG ATTTCCCTCGCTTCCTCCTGAACGACGATTTTGTTGAAGCCCATCGCGCCGCCCCAGATTCCGCCCCCGATTGAGAGCTT CTTCTCGAAGATTGCCACCTTCGCACCGTTCTTCGCGAGGTAGTAACCGGCGACCATTCCCGAAGGACCCGCGCCTACTA TGGCCACGTCAAGGCTCAGGCTTTCGAGAAGCTCGGCGGTGTAGGCCTCTATTATCGCCCTGCTTATCTCTATCTCCCTC AGCATCCCGACCACCCAAAACCTTTTAAGTTCCGCTCAAAACTAAGTTTTGAAATTTAAAAACTTTGTTATAAACGGGTT TTAAAACCGGGTGATTGGA atgacccagcttgaggccgcgaagaggggagagataaccgaggagatgaagttcatcgcc gagcgggagggaatagaccctgaaaagctcaggaggagcgtggcaaaggggtacacggtgatattcaggaacgtccgcca cgactgggttaagcctgtggcagttggcaacgtcgtccgcgttaaggtcaacgccaacattggaacgtcgcgcgacatag tgaacgttaaggcggagatagagaaggccaaggtcgccgtgaaatacggcgccgacacgataatggacctctcaactggt ggcgacctcgattcgataaggaaggccatcatgcacgccgttgacgtgcccattggcaccgttccaatctatcaggccgc cgaggagatgctggctaaggggaaggccatcatcgagatgagcgaggacgacatgtggaatgccgtcgagaagcacttca aggacggtgttgattacacgaccattcacgtcggggttacgaaagaggttgtcgagaagatgaagcgcgttaagcgcgtc gtcggcatggtctcacgcggcggaaccttcctcgcggcgtggatactccactggggcgaggagaatccgttctacaggga ctacgactacctgcttgaactcgccaaggagtacgacgttgttctgagcctcggtgatgggcttagaccaggcggtcttc cagatgcgggtgacgaactgcagattgccgagctttacaccctcggaaggctcgtcaggagggcgagggaagctggcgtt cagacgatggtcgagggtccagggcacgtgccgattgaccagattccagcccagataaagctcgcgaaggttgccaccga caacgcgcccttctacgtcctcggcccaatcgttaccgacatcttcccaggctacgaccacatcacgtccgccatagggg gagcgatagcggccctgaacggcgcggacttcctgtgctacgttacccctgccgagcatctcggactgccgacggtcgag cacgtccgcgagggagttatagcggcgaagatagccgcccacgcggtcaatttgacccgcttcgaagccgactttaagaa ggactacctgatgagccttgcgcgtggtaaactcgactgggcgaggcagttcgagctgagccaggacagagagaagttca tcgagataaggaaggaaaggccgacgaaaaccgaggcctgctcgatgtgcggtgatttatgcgcgataaagctcatcaac gacatgctgaggaagggg TGAGAGCTTGAGGCTCGTCTATTCCGGCAAGACGAAGGACGTTTACGAGGACGGGCCTTAC CTCGTCTTCCACTTCAAGGACACGGTTCTCGGTAGGGACGGCAGGGAAGACAGCGGGGGCAACGAGGTTATAGGGGAGAA AACCGGGAAGGGGAGCCTCGTTTTGGAGCAGACCGAGTTCTTCTTCAGACTCCTTGAGGGGAACGGCGTAAAGACGCACT TCGTCGAGCGGATTGACGGGAGGAAGGCCCGCTTTCTAAGGGCGGAGAAAATCCCGCTGGAGGTCATCTACCGCGAGCTG GCCTACGGTAGCTTCCTTCGGCGCTACAAGGGGTGGGCCAAGCCGTTTCAGAGGCTCGGGATAGTGGAGTTCACGCTGAA AGACGATTCGCTCGACGACCCGCTCATAGCGGAGGAAGCTATTGTGGTTCTCGGAATCGCGAGCGAAGAAGAGGTTGAGG TAATGAAGGAAAAGACGAGAAAGGTCGCGGGAATTCTGA