

>tg1271 Phosphomethylpyrimidine kinase (thiD)

>tg1271 Phosphomethylpyrimidine kinase (thiD)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1192855 - 1195138 (Additional range around tg1271 is :500nt.)

>Thermococcus gammatolerans EJ3 GTTCGGGATAAACTACAGGCCCTTCGGGAACGGCCTCTACGTTGCCGACGCCATCGAGACGGCTACGACGATAGCGAGCA GGGCTGTAAAGGCCGGCGTAAGGTTCTTCAACATGATTGAGGTTGAGGATTTGGTCCTCAAAAACAACCGCGTCGCGGGA ATAGTGATCAACTGGACGCCGGTGATGAGGACAGGTCTGCACGTCGACCCGCTCACGGTCGAGGCGCGCTTTGTGGTTGA TTCCACCGGCCACGGGGCGCAGGTGAGCCAGCACCTAGTGAGGCGCGGCCTCCTCCAGGTTCCGGGCGAGGGCCCGATGT GGGCGGAGAAGGGTGAGGAGCTGACTGTGAAGCATACGAGGGAGGTCTTCCCCGGCCTCTACGTTACGGGAATGGCCGCC AATGCTATCGCTGGAGCGCCGAGGATGGGTCCGATATTCGGCGGGATGTTCCTGAGTGGAAGGAAGGCGGCCCTCGAAAT CCTTGAGAAGCTGGGGTGAT gtgatggccgtcctgattgtagcgggcctcgacacgggtggcggggcgggtttaaaggc cgacatcgagacggtctccgctctgggcgagcatccgctcccggttctgacggcggtgacctaccagaacccctttgagg tgaggggctaccacacccttccgtccgaggtcgtgagggaggggatacgagccgttaaggacggctttgaggtcaaagcc gtcaaaatcgggatgctcggaagcggtgaggttgcccgggtcgtgagggaagagaccgcaggtttccccagggttttcga ccccgtgattgcctcaagcaccgaaaaaaagctcattgacgacactgagtcgctcaaaacactcgtccccggttcgatag tcactcccaacgtctatgaggctgaagcgctggcgagcattgaaatccgctctgtggaagacatgaagaaagcggcgacg gcccttgtggaggagtttggcgccgaggctgcggttgtcaaggggggacaccttaactttaccgacgtcctctactggcg cggtgagttctacgagttcaggggagaaaaagtcgaaggtttcacgcacggaaccggctgtgccttctcctctgccttgg cgacgtttttggccaaaggctttgagcttccgaaggccgttgagagggccaagcgcttcgttgaaggctcgataaggttc tcaaaagcagaatctaaagcggtgaatccactctgggagattgagagagatgcccaccgctggagggccagggaagagct tgaaaaagcggttgaagagctagtggcctttggggagaggctcaacccgcacgttcccgaggtgggaacgaacttcgccc tcgcgacgccctttggagaagtcttagccgtcaagggcagaatcgtccgctatggtcagactatcaagcccgttggccca gttgagctcaacgccagcgaccatctcaggagggcgttgctcaagatgcgtgagttctatccagagattaaggcggttct gaacctccgctactcggaggaactcgtggagaggtccaaaaggctcggcctcgtcgtttcgttctacgaccgcagggagg agcccgaggaagtcaagagggcagagagagggacgatggagtggggcatcgagaccgccgtaaagagggcaggaaaaagg cccgacgtggtttatcatctcggcgactggggaaaggagccgatggttctggtctttgggagggacgcgggggaggtcgt ggagagggtgcggaagcttttgggc TAACGTTTTAACTCCTTTTTCCTATTTATCCTGGTGGTTCCATGCTCATAAGGG GAAGGGTCGTCGGTAACGAAATCCCGCGCTTCAAGCACCGCTGGTTCGGAATCCTTGAGGTCGAGGCCGATGGGAAGAGG TACAGCCTCTACATGACGGGCAACGTCGCCCAGTGGTTTTTGACCGGCGACGAGGTCGAGGTTGAAATCCTCCATAAGCC GAAGGAAAGAGACGGAAAGCTGGTTCTCGACTTCGACGACTACAAACTGTGGAAGTTCTACGAGGGCGACAGGATTCCTG TGTGGCCCCTCTTTGAGAAAACCGTTGAGGCCAAGCGCTACTCACCTTTGACGGGCGAGCTCCTCTACACCTACAAAATC CGCGCCCGCGAGGCGAAATACGAGAGCGACTTCGAGGCGATAGCCGAGCTTGAGCAGTACCACTACGCGAGCCAGAAGGA GAAAGTAGCCCTCTGGCGCTGTGAGAACGGCCACATCTTCGAGGC