

>tg1286 Translation initiation factor eIF-2, subunit gamma (eIF2G) (eIF2G)

>tg1286 Translation initiation factor eIF-2, subunit gamma (eIF2G) (eIF2G)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1207093 - 1209325 (Additional range around tg1286 is :500nt.)

>Thermococcus gammatolerans EJ3 GTTCTCCCTGCCGGAGTCGTGGAGATCTACCGGGAAACCGAGGGTGGAAACCTTCTAATAGGGGAGAACCACATCGAGCA CACACCAAAGGGCGATGTGGTGAGAATCGGCATCGGCAAGGACTACGACCTCAAGGGCACTACGAAGGTTCTCGACTCAG AACACGGCGAGGGCTGGGCAAAGTACAGGATTAAGGTGACTATCGAAAACTTCGGCGACGAGTCGAAGACTGTAATAGTC CGCCACTACAAGTACGGTGGAAAGCTCATCAGCTCGACCATAAGCCCCTCTGATGAGACTGCGCAGTACGTGGAGTTTAT TCTCACGGTCCCGGCGGGCGGTTCGAGGAGTGTAACCTTCGAGTACGAGGTCAACTGGTGAATCCGCCTTTTTGTTCTTT TTCATTTCTCCCTTTTATCCGCGTTGATTCTTTCGCCCCCTCTCGGCAACGTGGGTTATGGATAACCTTAATAAACGTCC CCGCTTTTTAGCCTTAGGG gtgagagagatggcaaagaagtttaaacaggccgaggtcaacattggaatggtaggtcac gttgaccacgggaagacgacgctcaccaaggctctaaccggaatatggaccgacacgcacagcgaggagctcaggagagg tatcacgataaagataggcttcgcggacgcggagataaggaagtgcccgaagtgcgggcgttactccacttctccggtct gcccgtactgcggcgccgagacagagttcgagaggcgcgtttccttcatagacgcgccgggccacgaggcgctgatgacg acgatgctcgctggagcctctctcatggacggtgccgttcttgtcgttgccgccaacgagggggtaatgccccagaccag ggagcacctcatggccctgcagatagtcggcaacaggaacatcgttatagcgctcaacaagatcgagctcgttgacaggg agaccgtcataaagcgctaccaggagatcaaggacttcatcaaggggactgtcgcagagaacgccccgataatcccgatt tctgcattgcacggcgcgaacgttgacgtcctcctcgcggcgatagagaagttcatacccactccaaagcgcgacccgaa caagcctcccaagatgctcgtcctgaggagcttcgacgtaaacaagcccggaacaccgccggagaagctcatcggcggtg ttataggtggttcgatagtccagggcaagctcaaggtcggagacgagatagagatccgcccaggggttccctacgaggag cacggcagaatcaagtacgagccgataacgaccgagatcgtctcgcttcaggcaggtggaaggttcgtcgaggaggccta tcccggtggactcgtcggcgttggaacgaagctcgacccctacctcaccaagggtgacctaatggctggaaacgttgtag gaaagcccggaaagttaccgcctgtgtgggacgagctccgcatcgaggttcacctgctcgagcgcgtggttggaaccgag gacgagctcaaggttgagcccatcaagaggaaggaggttctcctcctcaacgtcggaacggcaaggacgatgggcctcgt caccgggctcggcaaggacgaggtcgagctcaagctccagattcccgtctgcgctgaggttggcgacagggttgccataa gcaggcagatcggaagcaggtggcgcctcatcggctacggcttcataagggag TGAGCCCTCTTCTCTTTCCTTTCCGG TGGTCGCAATGGTCCATAGGAGAGAATGGCTCGTCCTTCCTGACACGAACTTCCTCCTCGTTCCCGGCCAGTTCGGGGTT GATATCGTTGGTGAGCTCAACAGAATCCTCGATGTCAGGTTCAAAATCGTAATCCCCAACGTGGTTCTCCGTGAGCTCGA CGTTATAGAGCGGAAGACGCGAGGAAGGGATTTGCTCGCTGTTAGAATGGCGAAGAAACTAGCGGAGCGCTTTGAGACCG TTGAAATCGGGGAGTTTGGGAAGAGACCGATAGACGACCAGATCTACGACTTCGCGATCAAAAACGAGCGCGTTATCGTC TGCACCAACGACAAGGGGCTGAAGAAGCGCCTCCGCGAGAAAGGGATTCCTGTTGTTTACCTCCGCTCGAAAAAGATACT GGAGCTCGAGGGAATGCTTGAGTGAACCGTATCGGAAAATTTTAAACGTCTCAAACCATCTCCCAATCATGCCG