

>tg1287 hypothetical protein TGAM_1287

>tg1287 hypothetical protein TGAM_1287

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1208447 - 1210763 (Additional range around tg1287 is :500nt.)

>Thermococcus gammatolerans EJ3 CCCCAGAGGTCGGCGTCGGGCTTGTACTTCCTGGCGTTCTCCATGATTGTTCTGAAGGCTTCCCTCGCTTCCTCGTCGTT CTTGATGTTGACCTTAACACCACCGGCGTCGCTCTTGTGGATAATCTGCGGAGAAACGATTTTCATAACCACCGGATACC CGATTTCACGGGCGAACTTAACGGCCTCCTCCTCGTTGGTCGCGACCTTGAAGTCCGGAACCGGGACGCCGTAAAGGCGG AGTATCTCCTTCGCCTCGGGCTCGACGAGCGGCCTGTTCTCGGCCTTGGCCTTCTCGATTATCTTCCTTGCCTCTTCGAC ACGGCTCATTTCAATCACCTCGTAAGCCTGACGTTTATCACTCAGAGGGGAAGGTTAAAAGGGTTTCCATTTGCCAAGGA GTTAGGGCTTCCTAACGGCCCAGGAACACTTCAACGGCTTTTGAAGCTATGGTTATGGTATAAGTACCATGAAGAACCAA TTGTTCATGGTGATGGGAT atgagaaacgcgtttaaagttcttgccggggtggccctcgtgataatcctcatggtggcc ctccacggcaccgagcagatccgggccgcaagtagcgacacaacggttgccctctatgactcggccgagattggcgtcat cagcgaggttctgaacctgagccttaagaagggaatcaacagggttcagctggatgacctagccggcctgaacgttgagg agataacggtgagaccccttgaccccaacgtccagttcctcgggctctacagctctgaatcgagtgagaacatgtacgac tcgaacgtgggcagcgacgtcgaggtgaaaacctcgagcggggacgtaatcaggggcaagttcctcggtttaaaggacgg caagctcgtgatccagggtgaggacggactgtacgcggtgaatccgagcgagctggtctacttcaaagcctcgcggatgg aaaagaaaggcggcgtctacgccctcttctccgcccccgaagatggaaagtacgccgttgaagtgacctatcgcgtccct ggaatgagctgggggagcaggtacaaactctacctgggcgaaaaaaccgcccgcctttttggttacattatcgtgaagaa ccccacctcgaaggagtacgaaaatgccaaggtcgccctcgtctcgggtgacgttcagttttacagcccctattccccga ggtacgtttacaccctcgctgtggcggcggaaaagtcagggggcagtcagggagagccggttaaggtagaggccttccac gtctatcccctgggcccgacggacataaaggccgcgagcacgatgatgataccctacatctcgacggaggtggagataaa gaggcagtacctctacgagagctggagctatgacagaacggccaacgtttacgagtccatctccttcaaggctgacaggg ttctccctgccggagtcgtggagatctaccgggaaaccgagggtggaaaccttctaataggggagaaccacatcgagcac acaccaaagggcgatgtggtgagaatcggcatcggcaaggactacgacctcaagggcactacgaaggttctcgactcaga acacggcgagggctgggcaaagtacaggattaaggtgactatcgaaaacttcggcgacgagtcgaagactgtaatagtcc gccactacaagtacggtggaaagctcatcagctcgaccataagcccctctgatgagactgcgcagtacgtggagtttatt ctcacggtcccggcgggcggttcgaggagtgtaaccttcgagtacgaggtcaactgg TGAATCCGCCTTTTTGTTCTTT TTCATTTCTCCCTTTTATCCGCGTTGATTCTTTCGCCCCCTCTCGGCAACGTGGGTTATGGATAACCTTAATAAACGTCC CCGCTTTTTAGCCTTAGGGGTGAGAGAGATGGCAAAGAAGTTTAAACAGGCCGAGGTCAACATTGGAATGGTAGGTCACG TTGACCACGGGAAGACGACGCTCACCAAGGCTCTAACCGGAATATGGACCGACACGCACAGCGAGGAGCTCAGGAGAGGT ATCACGATAAAGATAGGCTTCGCGGACGCGGAGATAAGGAAGTGCCCGAAGTGCGGGCGTTACTCCACTTCTCCGGTCTG CCCGTACTGCGGCGCCGAGACAGAGTTCGAGAGGCGCGTTTCCTTCATAGACGCGCCGGGCCACGAGGCGCTGATGACGA CGATGCTCGCTGGAGCCTCTCTCATGGACGGTGCCGTTCTTGTCGTTGCCGCCAACGAGGGGGTAATGCCCCAGACCA