

>tg1300 hypothetical protein TGAM_1300

>tg1300 hypothetical protein TGAM_1300

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1222494 - 1227129 (Additional range around tg1300 is :500nt.)

>Thermococcus gammatolerans EJ3 TAAGACTCTAGGAGAATTGAAAGACGGGAGCACGGCGGAGATCGAGTACACGGTCAAGGGTTGCAATAAGACTCTAGGAG AATTGAAAGGGTTGAACGTCACGAACTGGCTCAGGCCTTCGTACAGGTTGCAATAAGACTCTAGGAGAATTGAAAGCGGA ACAATAATCGGCGAAAAACCACTTTATCTTATCGAGTTGCAATAAGACTCAAAAAGAATCGAAAGAATTCCTCTCCGGAC ATCTTTTAGATAAGATCACGGTCGAAAACCCCCGCAGATCTCAACTTTCCCCCTACCTATTGGAATATTTCTCCAAGGAC GGGCTTTTATCCAAAATCATGGGAGTAATTTATCCTCAATAAAAATTCATTTCCATCCTGCGATATTCTTTAAAGTTTCA ATGCACCTTAAATTTTCAGTTCAATATAATACAATGGGACAGAAAAAATTTTTAACAGTAACTTTCGAGAACAGGACGTA ATGGACTGGAGGTGAACACT gtgaaacagaataggaaaacaacttggcatattgcaatcctgattggggttctggtgct ggtgagcactgctcctctggagcacccagccgaagcttcaaacacatccattcagggatacgtggatgcccttaaaagcg cgttccgcgagcttaccgacagggatctccagggcaccgtcgaggtaactccaggctcagggtttgaaatagatcccaac gcaaaagtcgtgaaagttggggccgacgagttcacgaagtcctaccacggtatcattgggggcaggggcttctacctggt cgcctacgggctggtcaacctctccatccccaacctgcccggaaacggcgcagatcccctgtggcacttcaaccttacgt tgaagaagggcgaattcaaaaccgaactcgccactgaggtcgtgacctactggctcctcgagaaagtcggaagctacaat ggggtcaacctgaagaagatcgcagagtacaggaagagtgaggtgataagcgagtacaaaaagatcggaaaggccaagca ggtggagtggctcttcaagtacctcaacgacaagacgatcaaggacgtcattaccggtgtgtactggggagactatccgg acgtttacggctggacgtgcaagagctccctcctgtacagggagatcaagaaaacctatccctacgtcaaaccgcccgtc ccgctctcaagcccaaagaagatagagcatgactcctgcctgataaacgttctgccgatctaccaccttggaataaagct cggcaacgaaaagctctcctacacggtaatcctcttcaaccacacctcgcgggagtatataatcggaataaacaagacct cttcgggctacacagtcggcctttggataaagtacctcaacatgacgacactggaggtaaagcccctctggttcgactcg tccgaaaagctcaccctgactttcgtcgacggatacaacctcactatcagctccgctgacgtcgggaagaccttcacaac tcctctcgctggtggattctgggagttggagtatctggatctgtacttacactcctattggtggggaattcatgaggtgc acaaacctaagctcaagtggtatgatcacaagggatacgttatcatagaagagtacctctccagccttgctggcgactct ctgagagcatccttaaacgtctcagcctggagtgataagatgctcaaaattgaaatgctctacctcgtggacagcagcta caagcaggagattgactacggaaacgccacagtcaacctaacgcttgaagacatcgggaagactttcatacttgataggg agacgggactcgtggtagggcttcaaggcgaagcacttccaggatggagctttgtggggaacacaagaatcgatccgagg aaaggggtcataattctcacccccgacgagtggggaaggaggggtgcggcctggttcgataagccagttgacctctcccg gcccttcacggcaaccataatattctacgccggacacaaaggaggagcggatggaattgcggttggctttcaagccagag gacttgacgcccttggagggagtggaggcgactgcggtttcaagggcatcaccccggccgttgggttcaagctctgggag tacaaagaaaaggtaaccttcgtggacgatggaaacgaggaagacgttaccgggggagtttccttcgccgacgggaagga gcacgtgctcaagctttcatggaacccgacaacgaagagcctcacccttgaggtcgacggccacgtctatgccagcagaa ctatcgatctgaacgcaaagttcggatccgcaaaggtgtactttggagttaccgcggcaacgggtggaagaacaaacctt cactacttcgtgccggccgatgagttcatgctcgccgccgtgcctgaaaaggcaaagacaatgctctccactttgagtgg actcgggcgggataccatcgagctcgcccctattgtcagcgatatggaaaccgctctaaaggaagaaaactaccggaagg tgctccaggactattacaccttcagaactcaactggttagaaggactcttccagagataaaggagaacctcaaggacacc cttattgtccagcagatgaacatctcctcgatagcacttgatgcgctggtacaggccattaagaaggcggcgtttgaggg ggacgtggtctcagcccttaactactccgaatccgcccacaaccttgcgctcaatatgagcgagcagaagatcgcggaga tgatccgggagatcaacaagctcaaggagcagctgagggaacacggggtctcggtgtcttcaatggacgagaagataagc tcaatagaggagctcagaaaagagggcagatacgtggaggcgtgccgcgttgccgcatcgctcgagacaaaactcaggga agtactcaacatgaccctcatggtggaggagaggataacgggcctccagagcctctacaaagcctcaaagatcggggaga tcagtgaggatgagttcaacgccggaatagcccgggccaaagagctcatgagggagtggaagttcagcgaggccatgagg gtcctctcggatctggagaagaagataatgccctggcagcttgttggagatgcgtactttgacaactctacaggtgtaat agttcttacacccgatcaggcctccaagagaggagctgcttggttcaaataccaggtgaacctctctaggccattcaagg cgatcttgatgttctacgctggaaggcagagtggaggtgacggaatcgcggtcggcttccagtctctgggtcccaaagcc atcggaggatatggaagcgattgtggtttccgcggcataagcagggccgttgggttcaagctctgggagttaaacaggga aatctacctcgttactcccggaggagaaaggaagctcgctgacgtcagcttcgcggacggtaaggaacacaaaatgacca tctactgggatccaaagaccaagactctgaccctcgaagttgacggcaggaactacacccaggtgaacgtagacattccg gcgttgcttggctccgaaacggcctacttcggcgtcagcgccggcaacggggccgcccacaacctccactacttcgtacc acttgccctgtacgttccaggggaaatgaaggcgaaactcaagataacaggaacccctgagggagccgaagtctacatca acggaacacttaagggcaagattccggtcgaactcacgctcaagcccggcaaatactcgatcaccattagaaaggagggt tacaatgagaagagcctgaccatcacactgaaacccggggagagcagggaactcagtgtagccctcgagaaggttcagac ttcaacgacttccgtcgtcaggaccacgacctcttccaccacgcacagggaacactcgacgacctcaacgaccacaacca cctccaagactggagaaacgagctcgactacagaaaacaccggcacgagcagcagctcaaagagtggtggcggcatttgc gggcctgcctggctcgtactgctcgtactgttgcccgtactcgcaaggaggaggcgc TGAGCCCCTCCTCAACTTTTTT CAACTTCCACCCCATTCTTCCACAATTACATAAAAACATTAACATGCAATTCTGCAATTGGGTAAGATTAAGTGGACTCC GCCATCTCCATGACCCTGTCGAAGACTGCCCCGTGGTTGCCGAAGGCCTCGAACATCCTGTCGGAATAGCCCTTGGACGC CGTCTGGAGGAAATCCCAGAGGTTGCGGTTTATTTCATCGCTCACTGGAACGTGGAGGGGCATCGGCTCGTAGTAGTCTA GCCCCTTTATGAGGGCCGTTGAGAAGTACCAGAGTGTTTTTCTCACCTTTCTCCCGCTTATCTTGGAGAAGCTCGCCTCC ATGCAGTTGAAGGCGGCGTGGAGAACGATAATCATGTTGATCTCAACACCCTTTCGGAGGAGTTTTAGACGCCCCCTGTT GGAGGACAGATCCTTGATCCTGTACCCGCTTTTAGTCTTCGTATCGTAAGGAACCTTGATGCCGTAAATGCCCTCCA