

>tg1305 Geranylgeranyl hydrogenase

>tg1305 Geranylgeranyl hydrogenase

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1228912 - 1231096 (Additional range around tg1305 is :500nt.)

>Thermococcus gammatolerans EJ3 AGCTTGAGGAAGTCCTCAGGGAGCTCCAGGCGATAGAGAGCCAGCGGAACAGGCTCATGGCGATGATCAAAGAGACATAC CTCAAGGAAATCGGTGACATGACCCAGCTGGCAATCCTCCACTACGTTCTCCTCAACGGCTCGGCCACCGTTGACGAGCT CAGCGACAGGCTCAACCTCAAGGAGAGGGAGGTGCTTCAGAAGGCGAGCGAGCTGGACAGGTTCGTTCCGTTAAGAATAA AAGACGGCGTTATAACGATAGATGACGAAAGGCTGAAGGCAAAGCTCGGCGGTGAAGGCGATGCCGGAGAAGATTAAAAT CGTTGTTAACGAAGACCGCTGTTATCTCTGCGGTGGTTGCGCCGGGGTCTGCCCGACGTTGGCGATAGAGGTGCACTCGA GCGGCTGGGAGTTTCTGCAGGACAAGTGCATAAGTTGCAGGATATGCATCAACGCCTGTCCGGTTGGAGCGCTGAGCGCC GAGCCCCTGGAGGTGAAAGC atgagctggaagtacgatgtcgtcgtcgttggggcaggaatagcagggcccatagtcgc cagaaacgttgccagggcaggtttttctgtcctgctcattgataaaaagtgggcgataggcactccaaagcagtgcgccg agggcataagcataaaggtctttgagaagtacgacattccctacgacaagcgcttcatcaaccgcgagatttacggagca aaactctactccccgagcggttacgagcttgagatgaggtacaaggacgtcagcggtgttatcctcgagaggaaggtctt cgacaagatgctcgcctactacgccgccaaagctggagccgacgttctcgcgagaactgaggccttagacgtcataagga aagatggaaaggtcgttggaatcaaggccaagcacgaggacgagccgattgagatttacgccgacgttatcgtcgcggct gacggcgttgagagcacgatagcgaggaaagccggcataaacacctacgccccaccgcatgagttcgattcgagctacga atatgagatgctcatcgagggattcgaccccgatttaatccacctctggttcggcaacgagatagcacctcgcggttacg tctgggtcttcccgaaggacgaggacagggccaacgtgggaattggaattaactccgacaacccgcagacggccaagtac tacctcgacaagtggctgaaggagaacaacataccagctaagaagctcctcgaaataaacgtcggagtcgtcccggttgg aggcttcgtcaaggagctcgtcaagaacaacgtcctcgtcgtcggcgatgcagcaaggcaggtcaacccgatgcacggcg gcggaatggcggaggcgatggaagcgggaacgatagcgagcaagtggatagtcaaggccctcgaagaggagaacctctcc ctgctccagaactacaccaaggagtggtgggagaccgacggaaagaggcttgaaaaggttctaaaggtcaggcgcgttac cgagaagctcacggatgaagacctcgacctcttcatacaggttctcagcggagcagatgcggagaagatagccggcggag actacggagaggtcataaaagccctcctcaagcatccgaaggtcctcatgagcaagagaaggctgagccttcttaaaagc cttctc TAATGCACCTGATTCCCTTCCCCATTTTTCTTGAGAACACCACGATCTCAGCGGGCTTGCCCATTTTGATACT GCCCCACGGGAAGTTAAGCCTCCTCTCGCCTTCAAGTCTGTAAAGTAAGACGGTGTCACCATTGTCCTCAACTACTGTAA AGCCCTCACTGTTCTTCAGGCATTCTATCACCTCACACCATCCATCTCTACAAGGAAGTGGCCTAGGAAGTAAGCCCTCC AAGATTTCCAGATGGACGAGCCTGGAAAGACTCTCAATTTCGGGGGGACTCATAGTGTACAGTCTCCGGAGTGCAACGAG AAAAACAGGGAATCGTCTGTCTCCACTTTCAACACCGTATCCAAGCTCTCTAAAGGGATCCCGTGGAAAATCTCCATGAA GGGCATTCCTTAGTTTGATTATCCTGTTGACCCATACCTGTATTTCCAGTGGCTCCCCGAGGAGGGAAAAGCGCCTGTCG AGGGAAAAGCCCCTACTCAAGTTTAA