

>tg1320 Diaminopimelate decarboxylase (lysA)

>tg1320 Diaminopimelate decarboxylase (lysA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1245195 - 1247427 (Additional range around tg1320 is :500nt.)

>Thermococcus gammatolerans EJ3 CCAGATGGGCCCGGTTCGGTCTGGCCTTCGCTATGAGCCTCATTCTCCATTTGTAGAACTCCCACACCAGCTTGGGGTTT CTCCTGAAAGCTTCGGGAGTTGCCAGTTCTTCAGGTTTATAGTTCCTCCAGAGCCCGTTGGCGTCCCTGAAAGTGGGAAC GCCGCTTTCTGCGCTTATCCCCGCGCCGGTGAAGGCTATGGCGAACTTCGCCTTTGCCAAAATCCTTCCGGCTTCCTCGC AGAGCATGATCCCCTTTGGGAGGCAAAACTTAAATTTTTAACTGACCAATTCTAAACGTTAAGATGGCATTCGAGTGGGT GTCGCCGATGGCTCCAATGGAAAAGGGGCTATTATCCATATTCTTCTGGGGCTGCACATAACGTCCTTCTACGAGTTCCT GAGGGAGAACATCATCGCGTACTACGTTCTCTCGGCGATGCTCCTGACGACGATCGGAGCAATCACCATAATGTCCATAC GTAAGGAGGAGGTGGGATGA atgtggtgggaaaaacccggtcatctgcgaactgttggtaacaggcttttcatcgggga gcacgacgtcgttgagctcgccgaaaaacacggaacgcccgtttacatctacaacctgggcagaatacgggacaactacc tcagaatgactgatgccctcaagaaagcagggttcagggaatggaggatacactacgcgatgaaagcgaacaacaacagg gaagtcctcggattgatcagggagctcggcggtggaatagatgccacctcgccgggtgaggttaagctcgcaagggagat cggcttcgaggacgatgacataatattcacgggaacatccctcagcaacggtgaccttgaattcctcgccaaaacgaaag tgctcataaacttcgactccatctcctctctgagacgcttcaacggcgaggaagggcgaaaggtcggcctcaggataaac accggcgtcgggatcggcagggttgagaagaccacaactggtgggctagaggcagggagcattcccgtcaagttcggaat ctccggaaaagccattgaccgggcctttgatctgatagaggagaagggcttcgagcttcactgcctgcaccaccacgttg gctcggactgggttggggagaagatcggcagatacttccaggcactggacaacctcctcaaggtggccgaaaaggcagag gctcgcttcggcggatccgttgaggttatcgacctcggagggggttacggagttccccacagtgccgaagaggaagagtt ccccgtttacgagttctttcagcgggttaaagagcacatggaggagtacggcttcggcgacctcaaagtcatcgtggagc ctggaacctaccttgtgagtgacgccggcattctggtggcccaggtcaacacagtggaggagaagaacgggaggattttc gtgggtgttgacgctggtttaaacgtcttcaactcgcccgccctctacaactactatcatgaaattgtggtctgcaacag ggtctccagcgaggagaagatggtcgccaccgttgtcgggaacatctgcgagagcggagacatatttgcggtagacaggg agctgcctaagatagaggaaggggactacatagccatactgaacgccggggcctacggatacgtcatggccaacaactac aacctccgccccaagggaaaagaagtcgtcgttggccggtcccgttcgattttc TGATTAATTCTTCCTATCCTGTTTG GAGACTTCCAGAGTCTTCGAACGTTTTTTGAATTTTCATTCAGATTTTCGTGGGAGGGTTTAAATTGTATTCATTTGGAC ATTGAACGGGGTGAGAGAGATGCCGGTCTCGGAGGGAGTTGAGAGAAAAAAGGTCACCACGTCACACGGTCGCTATTACT CCGCAAGAATAGCGGCGCAGAGGCGGAAAAAACTCATAGTGATCCAGAACATCAGACGGAGGAAGGGAATTCGGGGACTG AGGACAAGCACGATACACGTCGAGAAGAAGCGCATAACCCGGGGGGAGGCTCTGGCAATCCTCGTGGGGACTCAGATAGG TGCGGGAGTACTGGGCCTACCATATGCCGCCAGCAAGGTCGGTCTCATCCCAGCGCTGGCAGTGCTCATCGGCGTGATGT TCCTCATGCTCTGGACGGGCCTCATCGTCCTCAGGTTCTCGGCAGGAATGGGCGGGGCACAGATGAGCACGGTA