

>tg1343 hypothetical protein TGAM_1343

>tg1343 hypothetical protein TGAM_1343

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1265097 - 1267665 (Additional range around tg1343 is :500nt.)

>Thermococcus gammatolerans EJ3 ACGTGACGGCCTTCGCGGCGCTGAATTACGCCCACGGCTTTATCGACGCCGGTGTAAGGCTCGGTGTCTTTAGGGGTGAA GACGACAGGCTTTTTGCCTTCGGGTGAGGTGGGACCATGGGGGACTACGTCGTTGTGCTCGAAGCCCCGATAATAGTCAA GGATGTGGAAACGAGCGAGGACGCGATAAACGTCGCGGTGAGCAAGGTCGCAAAGGCCCTCAACAAGGAGAACCTCGACT TCGTGAGGGTTGAGATTGGCTACTCCCAGTGCCCCGTCTGCGGCGCCCATTTCGAGAGTGCCTTCGTGATAGGCTCCGTC GGGCTGGTTGGGATATACCTCACGCTCAAGGTCTTCAACGCCCAGAGTATAGAGCACGCCGAGAGAATAGCCAAGGCCGT GGTTGGAAAGGCCCTCAAGAGGGTTCCACTCAAGGTTTTTGAAATAAGGGAGCTGGAGGAGGAGAATGGGGACGGTCTGG AGGTTCCGGACGAGTTCGA atgagcggcaactttttattatccccctcgattccactccgggtgaaggaattgaaggtc aggttactcgtgctcatccttctgctctcaactgccagcctcgcccaaggggcagtcatgatggagggaactacctccgg actcggctcttttattgcgatagatgccagtggaaacaccatcatcgcggccgggatatccaacggaacaggcatcgggg acttcgacgtggtgctcgttgcgttcaaggaagatggaagggttctctgggagaaggcatacggtggaaccggcagggat cttgtgtcgagtgttaaagtgctcccggacggttcgatactggtcgcggggggaagtgcgtccttcaacgggggctgggt ctttctggttggcgaggatggccggatagcgtggagcagggtctacaacaccgagatgatatactctgctcttccctacg gaaacggaatcctcgcgctctcatccgccggggaaaaacctctcctgctcaggctggattcagaggggctcgttgaaagc gcctatgtgattaacaccagcctcagggttgttccggtcacgatgaggatccttccgggtcagggggtttacatcggcgg tatcgcccagtccaacgccaccggctcactggacttctggctggcgaaggttggagagaacggagagttggtatgggaga gaacctacggctttgaggggatggatagactctatgatgtggaggtcgacgggaggggtgtgaccttagttgggtacagc accctcttcaacaatgagaccaacgtcaaccttttagttgtcagaacgaacctcgatggaaagctcctctgggcgagggt tgttggcgggccgagggaggactgggcaaacgcggtttcgctccttcccgggggaaaacttgtcctcgggggcataacgt attccgcccaaactccgcaggcgtggcttctcttcatggacgagtatgggactatcggggagtccgtcctaatcgggagc agggggatagactggataagggcactcacatcccttccctcagggggaatagttttcgcaggtgggctgaacggatcgag cctcggcacagggagtcttgggaagtcaagctttttcctcggtgtgttcaaacaggatgagagctttgcaaattgccacg tctcggttcagaggctcgactttccagttgagagcgttgcgcccataacgtgggttcgctccggaggaaatcccctcccg gtgagcgtctcggttaggaacgtcgccccccaggccaaaaccatcaagaacggcctcaaagccctctgtcccctcgaaaa ccccgacaccacgagcaccatgacaaccacgtcccacacaaccggaacaaccacaacaaagaccaccgtagctaccacta cagccaccactacaacgactgccactacaacgacgtcaacgatcccctcgaccacaaccacttcaaagaatgagggctgg aagctctgcggtcccgggcttttgatagcattgcccctcctcacgcttttcttgaggaggcgaaaggca TAAACGCCCT TTCTCCATTTTATTACGGTGAGCTATGTGAGGGTGTACGTACTCGTCGAGGACTACTCCGGCTACGAGAGCCCCTTCCTT GCCCAGCACGGGGTGAGCTTCCTCATCGAGGCAGATGGAAAGAGAATTCTCTTCGACACCGGTCAGAGCGCCGAGCCCAT TTTGCACAACATGAAAATTCTCGGAATCGATCCGGCCTCGATAGACTACGTCTTCCTGAGCCACTGCCACTACGACCACA CTGGCGGGCTTTTAGGAATTCTAAAGGCCATCGGAAGGCGCGTTCCCGTTGTTGCACACCCCTTGATTTTCAGAAGGCAC TTCATCACCAAGCCGTACCTCCGCGAGGTGGGCGTTCCGTTCAGGCGGGAGGAAGTTGAGGAGCTCGCTGACCTCTACCT CACCGCAGACCCTCTTCCAATAACCGAGAACGTCCTCTCAACGGGTGAAGTAACCGAGCGGGAGGAGTTTGAGAGAACAG AGCTTGAAGT