

>tg1365 Calcium-binding protein, putative

>tg1365 Calcium-binding protein, putative

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1284716 - 1288436 (Additional range around tg1365 is :500nt.)

>Thermococcus gammatolerans EJ3 AAAACAGAAACTTCCAGCAAGGTGGAGGACACGGCTGAAAGTCACTCCTCAAGCGTCCCTTCGGTTTCCACGAGCACAAG CGAACAAACCCATACAGAGGAAACAACGTCACCGAGAAAAGAACGGCCCAAGGGTATCTTAACGACAAAGATCTTCAACA AAACCTTCGCGGTGAACGCCTCCCTCGTCCCGGATTCCACCTTTGACTGCCTGTCAAAAAGTCCCGATGTTATAAAGGCC TACTACTCCGCGGTCAAGAGCGAAAAGAACGTCAGCGATTTCTTCGACCTGAGCGTTGTGGAAGAGAGCTCCCTCCTCGA GCTACACAAGGCCCTCTACCGGGCCGTTGACTTCAAGGAGCTCCAAATAAGCGAGCCCAACTGCTCGGTCATCAGCACGA ACCTCGTGGCCTGCTCATACCACTACCATGCTGTTCTCATCAAAGAAGGCCAGGAGAAGACCGTTGAGAAGGACTACGTG ACTTTCCTCTCGGGAGACGT ttgcaaaatcgtctggacggaggcggaatcatgaaaaagatagttctcctgctgatcct cgttctgctgaccgcaccgttaaagttctcagttatggggcatgaacaaggccagagcactttcgtggatacggacggcg atggcttaagcgatgctttcgagatggcctacaacgaaacgtacttcggaatagtataccgtctcagccctaccaatccc gacaccgatggggacgggctgaaggacggggacgaattcttggttgggacaagcccgctactcaaagatacggatgccga cggcctgtgggacggtgaggaattctggatgggaaccagccccctgctggaggacacggacggagacggtctcacggact acacagaggtcgtctacatccccaaaaaatacaacattgcaccaccaaaccccctcgaccccgataccgacgacgatggg atgaacgatggggcggagtggagcagggcgcacagcgtggacaaattcttcgacggctacctgaaccctgacaaggacgg ggacgggataagagatggtgccgaggtgtatactttcgtatggaacggggagctttacacgaaatactgtgacctaacac ttgactgcgatggagacatgctttccgacgcggaggaactggaactcggaacaacaccgtacaacccggacacggacggt gatggactgctcgacgtccttgagctgaggttcggctccagccccttcaaaaccgacaccgacggtgacgggattgggga cttcgaggaggtattccccctgctggcgtacgagtacaagctcacggaggatatacgctccatcataggcggagaacccc cggagtggtgggacgaatcatgggcatggctctttatatccccacttaacaccaccgacatctgcgttcccacgatggaa gagcttgagtccgccattgagctgaatcaatatccgatggacgttgttaaaaagtacatccgcaccggcctgcacagcta tctaagcaacgtctacaccctcgactatccggaacgctacgagaggggggacatatacagcgacaacgccgtttgctacc tcggtattcccacagacccaacaaaatacgacacggacggagatggtctgagcgactatgaggagctgaattatcagccg gcatgtcctactccagggtgctccttagctgtctactggctaatgctcgacccgaacgactcggactccgacggggatgg agtaatagactcagaagacatagtgccggtaaactacgacctcgacggggacaagctcatcgagcaggacgtatgcgcct actataccgactgcgacggggataggctgagtgattactatgagcaattttttggaacggatcccaaaaacccggacaca gacggtgacggtttaaccgacggcgaagaaagcgggggcgacctaaacgttgcaagcaggatagcaagcaacgaaacccc ttactggcacaacagcgaccccaccaaaacagacaccgacggcgatggcttcacggacttcgaggaatacaaaagctgtc tctcctcgtggagatgtgtggtggaccccaacctgcacccggagacagctcccaacgtccagaagccagaatacaacaaa acgaaagagattgaatttgtcccccgaatagagagaagctacaacgtcacggtcaccataaacggcaaaaaacttgactc ctcgaccgttctcctcgagacggacagcttttccgttgaggtggaagcatcacctctcagggtcaccactggaaacgaaa ccaccgaaaagccccctcagagaatattcctctacacatccaaatacgggaactttgagttccaaggcagtagtctctca aagacattcacccttgagaacttcacaaggattggggttgagttcttggatcttttcatcagagttgactacgggagttt ctttgtggatctcgggtacgatttgaccttcaaatacaagaccgctccggaagtcgagcttgaggaatcaagctgggaca acaacctcgacgttggaaagctcgtcttcaagtgccgcttctgcaagaacgcgacgataatagtccctggcgccctcgtg aacggaagggaaaagaaagtcatcgaactgggaaggacgatgccccttaagtacctctacgccagaataatcccgcaccg atacacggtagccagtgaggccgacgtcggaactatctacacgaagtatgaggacagcgtcgaagtcctgaagaccggca aggacataggtctcctgacggccaagatggtagaggcgagaagtttgaggtcgaagataatatacggcatggtggcgact gccaaggggataaagactatcgtcggcggtgttgaggcgttcattccggaggacgagagcacggaggttgaggaggttca gaagcccaaaggagtcgaaactccaacatcgacgaggttcgacaaagaggcgttcaagaaaggcctgctcgactgggtca aggagaagctcgttgatgcaaccttcgactacgtcaccgaaaaggccgtcaagtacgcagacgccaaggagctggaggca aggagacacgaaacgacctaccacgtgacggttaaagcgtgcaacgacttcggttgcaaggtttacagcttctccgtcag ggggtatgcatatgagaccgat TGAGCTTTCTTTTCTTTACTCTCAATGAGTGGAGGTGGTGATATTGAAGAAAGCCCT GCTGGTTTTTGGAGTGATACTGCTCCTCTTGGCGGCGGGTTACTTCACAGGGTTCATAGACAAGTCCACCGTTGATGATC TACTCAAGAACCTTCAGAAGGGCTCGAATACGGGCACGACGGGGGAGAAAGAAGATAGCCATAAATCGGAAACTCCTTCG ATGACGGAAACCTTTTCAGAAACCTCGACGGCTCCGGGAGAAAGTTTCAGCGAAACAACCAGTACGGAATGGGATCAAAC CGAGACCCCAAGCCCCGGACAGGGAACAACGCCAACAGAGAGTGAACTCAAGAACTTTTTCGACCACTCCTACTCCCTGG GGACGCTGAGCTTTACCGAGGGGGACTACGATTACAAGGGGCTGAAGATCACCCCGGAGAAGGGAAGGCTCTACTACTTC CCATACACCTCAAGTCTCGTCTATCTCGTGTCTGGCAGGATA