

>tg1366 hypothetical protein TGAM_1366

>tg1366 hypothetical protein TGAM_1366

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1287465 - 1289922 (Additional range around tg1366 is :500nt.)

>Thermococcus gammatolerans EJ3 AACTATCTACACGAAGTATGAGGACAGCGTCGAAGTCCTGAAGACCGGCAAGGACATAGGTCTCCTGACGGCCAAGATGG TAGAGGCGAGAAGTTTGAGGTCGAAGATAATATACGGCATGGTGGCGACTGCCAAGGGGATAAAGACTATCGTCGGCGGT GTTGAGGCGTTCATTCCGGAGGACGAGAGCACGGAGGTTGAGGAGGTTCAGAAGCCCAAAGGAGTCGAAACTCCAACATC GACGAGGTTCGACAAAGAGGCGTTCAAGAAAGGCCTGCTCGACTGGGTCAAGGAGAAGCTCGTTGATGCAACCTTCGACT ACGTCACCGAAAAGGCCGTCAAGTACGCAGACGCCAAGGAGCTGGAGGCAAGGAGACACGAAACGACCTACCACGTGACG GTTAAAGCGTGCAACGACTTCGGTTGCAAGGTTTACAGCTTCTCCGTCAGGGGGTATGCATATGAGACCGATTGAGCTTT CTTTTCTTTACTCTCAATGA gtggaggtggtgatattgaagaaagccctgctggtttttggagtgatactgctcctctt ggcggcgggttacttcacagggttcatagacaagtccaccgttgatgatctactcaagaaccttcagaagggctcgaata cgggcacgacgggggagaaagaagatagccataaatcggaaactccttcgatgacggaaaccttttcagaaacctcgacg gctccgggagaaagtttcagcgaaacaaccagtacggaatgggatcaaaccgagaccccaagccccggacagggaacaac gccaacagagagtgaactcaagaactttttcgaccactcctactccctggggacgctgagctttaccgagggggactacg attacaaggggctgaagatcaccccggagaagggaaggctctactacttcccatacacctcaagtctcgtctatctcgtg tctggcaggataatactcgcagtttccccctgggacgatgacttcctcctgggctcaaaggcaacccccgagatagacca gtcgttcaagttcctgatcgtgcttcctgttgagcccaagaagctctccattctcacaggggaaggtaggatcccgagca tcatagcgacggacggagagggcaggctccatatcttcatagacccccagcaagttgagggggacgagataaactggtac atccctgctgggcacgtagtctacaacttcgacgcgaccggagttggcattggggagtatggcacgtaccaagaggacta caacatctacctagcatggaaaggaagggagctgagggtgtacacgtactcccacagaacccttgaggacatcgaggaag gcaagaacataaccgttgagcccgcagtatacaccctcccggaagatatcctggatgcgaacgtaatgctctacgatgac ttcatccttgtcctcacagagggaggaacgtatttagtgccgagcccctacggccgctacgccaacgacactaacatcta cagaatcgacgatcgggtggatatgataactggctgtggaacttggggcgatgcctcccccgatccaaccaacatgagct ttacagtgtattcctccggcagactctacgttctcagagtcctctacgcggaggaagagcggaagatcacagtaacgaaa gaggcatccttagacgccccaaacgtagttggcatattcagtcctatgacaatagacggctcacagattgttgcagtctc agagtcgagtggagtgctcaaggtgtatcacatcaactggagcaaagaaaccggcagaaaagaattcaacctcctccagc agttcaaaccgggcgttcccctcgtgaatttccagttcgggaacttcctcggggcgatagcgagcggggtcggaagggac ggtgcgttctacataatagtaatgcggcagagcaacacc TGACTCTGCGATTTCTTTTTAACCCCTTCGATTTTTCTTT TAACGGTGATTTCAATGGAGCGCGTCGTTGAGATTCTGAGAGAAATCCTTGAAATTCCGTCACCAACCGGCTACACTAAG GAAGTTCTCGCACACATCGAGAAGAAACTGAACGGGGCAGGGATAAAGACCCGCTACACCAACAAGGGAGCCCTTTTGGC CTACAACCACCCGGAGCCGGAGCTCGTCATAGCGGGCCATGTTGACACGCTCGGCGCGATGGTTAAGGGAATCCTCCCCG ACGGGCACCTCAGCTTCACGAAAATCGGCGGGCTCCTCCTCCCGACGTTTGAAGGTGAATACTGCACGATAATAACCCGC TCAGGGAAGAGGTTTAGGGGAACGCTCCTCCTCAAGAACCCCAGCGTTCACGTCAACAAAGACGCAGGAAAAAAGGAGCG CAAGGAGGAAAACATGTACATCCGCCTCGACGAGCTCGTCGAGAAGAAGGAAGATACTG