

>tg1377 2-ketoglutarate ferredoxin oxidoreductase, subunit alpha (korA)

>tg1377 2-ketoglutarate ferredoxin oxidoreductase, subunit alpha (korA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1295808 - 1297953 (Additional range around tg1377 is :500nt.)

>Thermococcus gammatolerans EJ3 GAACCACCCCAAAGGCAGAATCATAGTAATTCAAACAGACGAAAAAGAGTGCCAAATCCTGATAACACATCACGCACTTT CCCGTGCAAGGCGCTGGAAACTCTCGCTTGAAAAGCTCGTGGAAGCGATACTGTATCCTGAAGAGGTCCTAATGGGGCAC CACGACAGGTTTATAGCACATAAAGCAGAGAATAGCCATATTATCAGGGTTATCTACGAGTATGAGAATGGCGTTCCCGT GGTTGTGACGGTGTATAGACCGCGTAAAGAGCGTTATTTCATAGGTGGTGGTGTTTATGAAGATAGAGTACTCGCAAGAT GCTGACGTCTTGATTATCCGCCTTAGAGATGACGAAGTTGTTGATTCAGTTGACCTCGGTGAAGGTGTCATCGCGCACCT GAACGAGAAAGGAGAAGTCGTTGAGATTGAAATCCTCGATGCGTCCAAGTCCGTTGACTTCAGGGAGCTTGTCCTCAGGA TTCCGAGTGGGGTGGTAGC atgaggtacccgtttccggtcggcaagtccgacttcattcaaggtgatgaggccatagcg agggcggctatcttagctggttgcaggttctacgcgggctacccaataacgcccgccagcgagatattcgaggcgatggc cctctacatgcccctcgttgacggtgtgagcatacagatggaggacgagatagcgagcatagcggcgataataggcgcct cctgggctggggcgaaggcgatgaccgcaacgagcgggcctggcttctcgctgatgcaggagaacctcggctatgctgta atgaccgagacgccgatagtcgtcgtcaacatgatgcgcggtggtccatcaacgggccagccaacgttcccggcccaggg agacataatgcaggccatctggggcactcacggcgatcacatgctcatcgttttaagtccctcaaccgttcaggaagcct ttgacttcactattagggccttcaacctggccgagaagtacaggactcccgtcgtaatccttggagacgccgagctcgcc cacatgcgcgagcgcgtttacattcctgagcctgaggagattgaggtagtcgagagaaagcttccagccagcgaggagga ggctaagcttcccttcggcgacccgcacggagacggcgttccaccaatgccgatattcgggaagggctaccgcacctacg tgacgggtttgacacacgacgagtatggccacccgagaaccgttgagcccgaggttcatgaaaggctcatcaggaggatt taccgcaagatactcgaccacaaggacgagataattagcagggaggagttcatgctcgaagacgcggaggtggcgatagt cacgaccggaatagtctcccgctccgccataagggccgttaagatactccgcgagaagggggttgaggcgggcctgctga agctcaacacggtgtggcctttcgacttcgactacatcgaggagctcgcggagcgcgtggataagatatacgtgcccgag atgaacctcggacagctctaccacctcgtcagggaaggcgccaacggaaaggcggaggtcgagctcatagccaagatagg cggcgaggtgcacacgccgatggagatagccgagagggtggtggga TGATGTACCTGAAGTCCGCTTACGAGATTCGCG ACAAGTACCTGAGGAAGGACATGTTGCCCACGATATTCTGCCCGGGCTGTGGAATCGGTAGCGTCCTCCAGTTCACCCTC CGCGCGATAGACGACTTAAAGCTGAACCAGGACGAGATAGTCTGGGTGAGCGGAATAGGCTGTTCCTCCCGCGTTCCAGG CTTCGTCAACTTTGACGGCCTTCACACGACCCACGGAAGGGCCCTTGCTTTCGCCACGGGAATCAAGCTCGCCAATCCGA ACCTCAAGATAATCGCCTTCATGGGCGACGGCGACGCGGCCGCGATAGGCGGGAACCACCTCATCCACGCCATCAGGAGG AACCTCGACGTGACGGTAATCCTCATCAACAACTTCACCTACGGAATGACCGGCGGACAGGTCGCTCCGACCGCTCTGAA GGGCCTGCGCGGGACTACCGCTCCATACGGCCAGTTCGAGAACCCCTTCGACATCGCTCAGCTGGCG