

>tg1402 Glycerol-1-phosphate dehydrogenase [NAD(P)] (egsA)

>tg1402 Glycerol-1-phosphate dehydrogenase [NAD(P)] (egsA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1317190 - 1319236 (Additional range around tg1402 is :500nt.)

>Thermococcus gammatolerans EJ3 ACGGTAGAGGGGATACAACTTTTCTCCGGTTCCAACGTGTCTCCACACGACGAGGAGCGATGCTATCGCGAAAGCAGCTA TCACGAAGTAGCCCCCTGGGCTCACGGTGAGGTACGTCCTGGGGAGCATCCCTACATCGGTCATGGCCCTCATTAGTGGC CCGAGGAATATGTAGGGCATCAGCGCCACGAAAAACCTCTCGTCCACCTTCACCCCAAGCCGCTTGAGAAACCGGTAGAG CAGCAGAACCGCGATCCCGAGGATTATCGCGTACACGAGCGTGTTCACGGGATTGTAGCCCTGGTTGTACTTTATTGGAT CCACGAAGTACCTCTGGAAGAACTCCTGAAGACCCATCCGACCACCGTGTAAGAGTCGGGGCCGGACACTTAAAGGTTTC CTCCGGATTTATGCCGTATTTATACCGTGAACTTTGACGTTGTTCCATCACGTGCCCAACCCAATCAATTTTTAAGTCCC GGCACCTTAGTTAGATGAG gtgaagaaagtgcacctgatggagctcccgcgggaagtgcttttgggcgagaacttggca ggggaaaccgtgagcgttgccaagaggctaaagctcggcaggagggttctcgttctctacggccccaagacaaaagagat agcggggggggaggttgaggaaaacctctcccgcgagttcgaggcttctggagtcgtagttaggggagccactatggagg aagttgagagggtcattgccatagccagggagacctccgctgactggatgatagccgttggtgggggcagtataatcgac gttgcaaagctctcctcgtaccgggtgggaatccctttcgtcagctttccaacgacggcttctcacgatggaatagcaag cgccaacgcctcaattaaggatctcggctcaaaaacgtcggtgaaggccaggcccccgatagcggtgatagccgacgtca gtgtaatcaaaactgctccctaccgctaccttgcggcgggagttggtgatatcataagcaacctaacggcggtaaaggac tggcagttggcccacaggattcgcggtgagtactacagcgagtacgcggcatcgctctccctcatgagcgcgaaaatggt cataaagaacgccgacataattcggcttggaaacgaggagagcgtgagaaaggttatcaagggcctcataagcagcggcg ttgcaatgagcatagccggttcttcaaggcccgccagcggagcggagcatctcttcagccacgccctcgacatgcttgct cccaagccagccctccacggggagcagtgcggcgtcgggacgataataatggcttaccttcacgggctgaagtgggagag ggttagggaaaccttaaagagggtaggggcacctaccaacgcatacgagcttggaatcgatcctgagattataatcaagg ccctcactatagctcacaccataaggcctgagcgctacacaatacttggaaaggagggtctgacctgggaggccgctgaa aaggccgctaaaatcacgggggttatc TAACGGTCATGTCTTCAGAGATTAGGAGGTGTTTGAGATGGTCATCACACTG GTTGGGGAAAAACTGGCAAAACCCGGGCTTGAGTTCATCTATTACGGGCCCGCTGAACCGTGCAAGAGTTGCAGACTGGC AAGAGTTTGCGTTGGGAACCTCGAACCCGGAAGGCGCTACAAGATCGTCAAGGTAAGGAACATAGAGCACTCTTGCCCGT TGCACGAGGGCAAGGTTCGTGTTGTTGAGGTCGTCGAACCTGCAATAGAAATCCTCGTTGATCCAAGGACGGCCATAGTG GGCTCCAAAGTGACGCTGAAGTTCGTTGACTGCCCTGATCCAGAAAAGGCAGACCTGGTGAAACCAGAGGGTCTCTTTGA GGGGGACACCGTGAAGATCCTCGAGATCCTCGACGACGTGGAGTGTTCAGGGCGGAGATACAAGCTCGTCCGCGTCGTCC GGGAGAAGGAGTGAGGTTTTCTTTTTTATAAATCTTCGGGGGGTGATG