

>tg1425 Type II DNA topoisomerase VI, subunit B (Top6B)

>tg1425 Type II DNA topoisomerase VI, subunit B (Top6B)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1336951 - 1339633 (Additional range around tg1425 is :500nt.)

>Thermococcus gammatolerans EJ3 ATAGAGGTTGACAGCGAGACGGGAGAAGTTTTCATCACCGCCACGAAGAAGACGAAAGATCCCCTCGCCGTCTGGAAGGC AAGGGACGTCGTCCTCGCCATCGGGAGGGGCTTCTCCCCCGAGAGGGCCTTCCGCCTGTTTAACGAGGGTGAGACCCTCG AGATCGTGAACTTAACAGACATCGTCGTTGGAAACGAGAAGAACGCCCTTCCGAGGGTCAGGGGTAGGATCATCGGGCGG AGGGGGAGGACGAGGGAGATTATCGAGGAGATGAGCGGTGCCGACGTTAGCGTTTACGGAAAGACCGTCGCGATTATCGG CAACCCGATTCAGGTTGAGGTTGCCAGAACGGCTGTAGAGAAGCTCGCAAGGGGCTCGCCCCACGGTGTCGTTTACCGCT ACCTCGAAAGGCGCAAGAAGGATTTGGAGCTTGAAAGTTCGGCCTACTACGAGGCCCTCGAGGGCGGGCCCGAGCCTGAG GATTGGGAGGAGGAATGAGC atggccgaggcgagtcagctctttaaggagttcaaaatccagagcgtcagcgagttctt caggcgaaacgcggcaatgctgggctacactggaaaagtccgctcgctcacaacgctcgtccacgaggcggtcacgaact cgctcgacgcctgtgaagaggctggaattccgccctacataagggttgagattgaggaactcggaagggagcactacaag gtcgtcgttgaggacaacgggccgggaatcccggagaagtacataacccacgtcttcggaaagatgctggctggaaccaa agcgcacagaaacatacagagtcgtggtcagcagggtatcggtataagcggtgctgttatgttcgcccagataacgagcg gaaaggccacgcgcgtgattacttcaacgggcgacgagattatcgaggcctgggtgaagatagacgttgacaagaacgag ggtaaaatcgtaaagaaggagaagcaccccaatcccgacggctggcatgggacgaggatagagctcgaggtgaagaacgt caagtacatgcgctccaagcagggcgtctactggtacctcaagctcaccgccatagcgaacccccacgcccacatcgagc taatcgagcccgacggaaagctgattgtcttcccgcgttcgagcgaagaggttcccgagccacctgtggagatgaagccc caccctaagggagttctgacggacgacgtttacaggatggccaagaagactaaaaggcagagtgtgaggcgcttcctcat cggggagttctccaggataagcgacaagaaggttgacgagctcatcgagtacgtagccgctttaaggctcattaaaaagg tcggggacaagaaggttcaggaacagctctacgagaggctcatgaaaggtgaagtcaaggcagtcctccgctccttcagg ggttacaccaaggtcgtcaagcaggtcgcgaagatgatggagaagccacccgagaagctcacctggcatgaagctgaaga gatagtcgaggccttcaagtacatgaagttcctcgctccgccgacgcacggcctcaggcccataggcgaagagaacattg agaagggtttgaagggaatcctcaagcccgaattcgtgacggccgtaacgagaccccccaaggtgtactcaggtggaatc cccttccaggttgaagtcggccttgcctacggcggtgagataccgagcgggttcgagcttttacgctacgcgaaccgcgt cccactgttgtttgacgcgggctcgtgcgtaaccactcaggccgcacgctcaatagactggaagaggtataaagttgacg acctcgacagaacgcccctcgtgctcatgattaacgtggtttccgtccacgtcccctacaccggaaccggaaagcagagc atagcgagcgtcgatgagatttacaacgagattcgcctggccataatggacgcggcgagaagactgcagacctacctcag cggaaagcacaggcgcctctaccaggtaaagagaaagaagaccttcgaaaagtacgtgcccgagatagccagggctctga gcgttctgacgggcgagtccgaggagaagattagggagtacttcctaaacttcatcgagagtcacttcgcctcgaaggag gcagtggaggtgagcgagaatgcc TAAACGCAAGGTCATACACCGCGAGAAGCCCAAGGAGAAGTTCTCCTACGACCCG AAAAAGGTGCTCAGCAAGCTCGAAGAGTACGGAAGGAGCGTCCTTGAGGCCATCAAGTCGGGTAAGAACCCCTATTTCGA CATCCCGATGCGCGGACTCAACAACGTCTACTTCGACGAGAAGAGCAGGCTAATCAAGATGGGCGACAAGCTCTCAAGGC GTTACTTCCTCAACGTTGCTCATGCCAGAAAGTTCATGCAAACCTTGCTCATAATGGCCTACGTGAAAAGGCTCGTGAGT GAGGGCAAGCACGCGAGCCTTCGTGAAGCCTACTACGCCAACAAGCACACGATTCCCGGAACGAGGGAGAACACCTTCGA GGACCAGCGCGAGAGCGACCCGATTATCGAGGATTTGGAGAGGATGCTCGGTGTCCTGCGTGAGGAGATGCACATAACCG CTGACAGGCGCGGTTACATCTACGGCGACATAGTGATTAGGGAC