

>tg1427 hypothetical protein TGAM_1427

>tg1427 hypothetical protein TGAM_1427

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1339786 - 1342036 (Additional range around tg1427 is :500nt.)

>Thermococcus gammatolerans EJ3 CCAAAGAAGGAGAACGCCCTGATCATAGCCACCCAGGGACAGGCCTCGCGCGGCGTCAGGCGTTTAATCCACAGGCTCCA CTACGAGGAGGGCCTTCCAATCATCGTCTTCACCGATGGCGACCCCTACGGTTGGTACATCTACTCCACAATAAAGCAGG GTTCTATTAACCTCGCTTACCTCAGCGACAAGCTGGCAACGCCCGAGGCGAGGTTCGTCGGCATGACTATGGACGACATA AAGCGCTACGGTTTGGAGAACGTCACCGAGAAGCTCAAGGGGATTCCCCCTAACAAGAAAGGTGGCCCAACGGGCGACTA CAAGCGCATTTTGGAAGAGATGGAGTACCCCTGGTTCCAGAACAGGGAGTGGCAGAGACAGCTCAAGTTAGCGCTCAAGT GGGGCGTCAGGATTGAACAGCAGGCTTTGGCAAACAAGTCCCTTGAGTTCGTCGCCAAGGAGTATTTGCCAGAAAAGATA AACAGCGGTGATTTGCTGCC atgacgacgactgaggagctcgtcgcccaggtcaacaagatactcgacgacatcgggat agacctgggtgagctctttgaggagttcgagcccgttaaattagcctacactttggctagaaacgtttcccttttgaatg acctcagggaggagcttgagaggcgcgttggggaaacggccccctccctccgcttcatggacaagaagaaccgggatcca cacctccagtggatttacaggaagaaacacaacagggctttggcactagaaaggctccactcagcgataaccgcccacaa gatggccttggctttgctctcggccaactacaccttcaagctgggaaaaagggagctgaaggcagaggagctaaaacccg aacacctgccaaaggtcaggacagtaccaaagccgattcaactcggcaggcttgaagttctcccacatctcgcttactca ggggacgtgctcagactcctggcgagggagagtatagaggtcagggagcagttcaagctcataaagggaaaactcaggga gaagggaatagtgcagaccaagagcatcaggatagaggtagagtacttcgaggagaacaggctgaagaagacgcgcctgg atcttccggcggacgctgacatagaggccgagctgagaaaacgctttggcagacggttccgctggagaatcctcagcttc atcaagacgaagggcgtgcttataaacaaccactacaccgtcgacaaccttgccctggcctacgcctccctcgatcccga gaaaggcgccgaaaagctcggcctcgatctcttccgctactacttcctcacctccgagacagaaaggcagagcctcggcc tctatccggacataaggctgtgcatagactgtcactactcaatctttgatctccccttccggcgcgagagggacttcaaa acgggctacgggagcatgctgataatccggaagtgtgaaatggaaagccagctttcggggaagagggccgagataagcac aattcccaactacgtccttgggggcgttctcctctacgggataagcggctgggatgaaaggaaggtcgccgaagttctcg cgatcccgctggacgagctggaggagggcctcaagaagttcgttatttcgggactccacaaggttctcttcatggagaat gagctcaaaaggttcgagaagttcatgcccaagagcgacaaggcgagggagttcctggcgctccttcagggg TGAGGAG ATGAGGGTTGAGGTAAAGGCCCGAAACAACGCCGAGCTCATACGGAAGCTCCGGGAGAAGCTCGGGCCGGAGGTGACGGA GGTCTACATAAACCTCCGCCCCACAAAGGAGATAGTTGTTAGAATCCTTGAAAACGCCCCCAACGTCCGCAAGATAAGCT GTCCGCCCAGCCTCTACCCGAAGGTTTCAAAGAAGATAATCCACGCCCTCTCCCAGATCGGCGTTCAGCTGGTTCCCGAG GGCTACCCTAGGGGGAGACCGAGAAAATACGACGAAAAAACTGTTCAAAAGATACTCACAATGCTCTCCGCAGGAAAGGG GCCGAAGGAAATAAGCTCCTCGCTCGGAATCCCCCTCAGAACGGTTTACTATCTCATTGAGCGGGCCAGAGAGGTGGAGG AATGGCCCTCAGACTTAAAGCAATGATCCTCTTTGCATCGCTTGTCGTGATAATGGCCCTCCTGCTCGGCCCCTCCGTGA GGGCCGGCGTCA