

>tg1435 ABC-type transport system protein, periplasmic component

>tg1435 ABC-type transport system protein, periplasmic component

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1346436 - 1348455 (Additional range around tg1435 is :500nt.)

>Thermococcus gammatolerans EJ3 TCCCTATCAACGAACTTTTGTGTAATCATGATTATGTAATCGTGATTATGTTATTTAAGGGTTTCGACGTCAAGGTCTCC CAGGTTCAGACGAGGTGGCCTTTCTCTTCAAGTTTTCAAAACTCCCCTCGCTTCCCGCTGTTAAGGGCGAGCAAATAAAT TTCCTCCTTCTTGTGTCACCGGCAATCGATTTTGGTGAACTTAAGGGGAAGCTTCCCTGCCACGCAAAAACTCGCGGACG AGACGGCTTTTCCCGAGTCCTCTCCTCTCAATGAAGAGGACGAGGGAGAATCCATCCAACCATAAAGCCCTTCGAGTGTT TTGAGCTCCTTTTTCTGCCCACAAATTTTCGAATCTCCCTCATAATATAATCGCAGGTCAAAACTTGATAAAAAGGCTCG TTGAGATGCTGTTTATGAAAACACTTCTATTTACGGTTAACGTTTTTATTTGCGCAAAATGTTTAAATACCAGCTTCTGT CCATTTCTTTGGTGGTGTTC gtgaagaaggccgtgcttataatgatcctcacccttctgctgtccgtcgtggcggctgg ctgtataaacggctcgaatgaaaaagaagagacgctgataatcttccacgcgggctcgctgagcgttccgttcaaacagc tggaagatgagtttgcgaagtacgccgaggagaacctcggagttaaggttaagttccaggacgaggcgagcgggagcgtc aaggccgttagaaaggttaccgacctcgggaagaaggccgatatagttgccgtcgcagactacaccctcatccctcagct tatggtgccgaactacacggacttctacgtcctcttcgcgaccaacgagatagtcatagccttcaccgagaagagcaggt acgcggacgagattaaccccgacaactggtacgaaatcctcgcgaggccaggcgtcactttcggcttctccgaccccaac caggacccctgtggctaccgctcgctcatggtcatgaagctcgcggattactactacggcaagcccatcttcgaggccct cgtcgagaagaacaccaacatccactacaacggctccctaatcgttgccccgaaggaaatccaggtgaagaacgacaagg tcgtcataaggccgaaggagaccgatttgacgggcctcgtcgagagcggaagcctcgactacttcttcatctacaagagc gttgcggagcagcacggcctgaagtacatcgagcttcccgaggagataaacctcaaggacttcaagatggccgactacta cggaaaggtgagcatccacatcggctcaacgggcaaggtaatcaaggccaagcccatcgtctacggcgtcaccgtcccga agaacgccccccacagggagctcgcaatggagttccttaagttcctcctgagcgagaagggcagggacgtcttcaaggcc aaccaccaggacttcatctggccgccgatagcgttcggcaacgtccccgaggagataaaggacgaggtgaaggtcgaggg g TGAACTTTTTATTCCCCTCTCCCAATTCAGGGGGAGAGCGATGAGGCGCGACTACACCCTCTACTTTTTCGCATCGCT GGGGAGCTTTCTCATCGCCTACATAGCCCTGCCTTTAGTGGTTATCTTCGCCAAACAGCTCTCGGACCTGGGGATGCTCG TTAGGACGCTCCACGACCCCTACGTAACCGAGGCCCTCAGAAATTCCCTCCTGACGGCGACCGCGACGGCATTAATCGCG CTCCTCTTCGGCGTCCCCCTCGGCTACGTTCTGGCGAGAAAGGACTTCCTTGGAAAGAGCCTCGTTCAGGCTCTCATTGA CGTCCCCATAGTAATCCCCCACTCGGTCGTGGGCATAATGCTCCTCGTCACCTTTTCGAGCGCGATACTCGACAGCTACA CTGGCATAATCGCGGCGATGCTCTTCGTTTCAGCACCATTCACGATAAACGCCTCGCGCGATGGCTTTTTGGCGGTTGAT GAGAAACTCGAGGCAGTCGCG