

>tg1437 ABC-type transport system, ATPase component, putative molybdate/sulfate transporter

>tg1437 ABC-type transport system, ATPase component, putative molybdate/sulfate transporter

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1348235 - 1350266 (Additional range around tg1437 is :500nt.)

>Thermococcus gammatolerans EJ3 GGACTTCCTTGGAAAGAGCCTCGTTCAGGCTCTCATTGACGTCCCCATAGTAATCCCCCACTCGGTCGTGGGCATAATGC TCCTCGTCACCTTTTCGAGCGCGATACTCGACAGCTACACTGGCATAATCGCGGCGATGCTCTTCGTTTCAGCACCATTC ACGATAAACGCCTCGCGCGATGGCTTTTTGGCGGTTGATGAGAAACTCGAGGCAGTCGCGAGAACCCTCGGCGCTTCCCG CCTAAGAGTCTTCTTCTCGGTCTCCCTGCCGATAGCCCTTCCAAGCGTGGCGAGTGGGGCGATAATGACGTGGGCGAGGG CAATAAGTGAGGTTGGAGCCATACTCATCGTCGCCTACTACCCCAAGACGGCGCAGGTGTTAATCCTGGAATACTTCAAC AACTACGGGCTGAGGGCCTCGAGGCCGATAGCCGTCCTCATGGTGACCATAAGCCTCACGATATTCGTCCTGCTCCGCTG GATTGTCGGGAGGAAGGCCA atgctcagggctgagggaatctccaaggactggaaggagttccacctcagggaggtaac ctttgaggtcaaagagggagagcacttcataatccttggcccgagcggtgctggaaagaccgtcctcctcgagataatcg ctggaataatagagcccgacgcgggcagggtttatctcggcgggagggacgttacagaactgcccccggagaagcgcggt ttggcttacgtccctcagaactacgccctcttcccgaacatgagcgtctacgacaacatagccttcggccttaaagtcag gaaagttccaaagcccgaaatagagcgcaaagtgcgggaaatctccgaggtcctcaggatagaacacctcctcaacagga agccgaggacgctgagcggtggggagcaacagagggttgcactcgcgagggcgctcgtcgtcgagccacccttaatcctc ctcgacgagcccttcgcgaacctcgacgtccagacgagggcgaagctgttaaccgagatgaagcgctggaagcgagagct gggctttacagctctgcacgtaacgcattcctttgaggaagcaataagcctcggtgaccgcgttggagtgatgctcgatg gaaagctcgttcaggtgggtaaggtcagggacgtcttctcaaggccggtgagtgaggaggtggcgagattcctcggcttc gagaacataatagagggaatcgcggagggaaggaggctgaaggtaaacggtattgagattgaacttcccgtcgaagctaa tgggaaggtcagggtcggcttaagaccagaggacataataatctcgaccgagccgataaagagctccgccagaaacgagt ttaaagccctcgttgagtcaatcgaggagctcggcccactcgtgagggttcacctctccctcggcgatataacccttacg gccttcataacccgctcatcgatgctcgaactcggggtggagaagggaaaagaagtctacgtcagcttcaaggcgagcgc gcttcacgttttt TGAAGAAGTTACAACTCCCGGTAGTTTTCCAAATTTTGCTTTCTCACCCTCGGAGTTTGCGAAATC TGGATAGAAAATGCTTATATATTTGGTGTGCATATAACATAACGATGAAGATGAGGGTGATAGTCGAGCGGGACGTCGAT AGAACTGTCAAAGAAATCCTGCCCTGGGCCACATCAGACTACCTCGAAAAGGCTATGGAGGAGAAGAAGCGGGAGATGGA TGAGGTCCTGGAGATCCTTGACTCCCTGAGCCTATCCGAGGTTCCGGAGGAAATCAGGGACATCGTGAAGAGGCCCCGCT GGGAGACCCTGCTCGCGGACTGAATCAGTACAGGATAACCTCAACCTCTTCCCCCTCTAGGTATCCTTCACTGTTCTCCG GAATCACCACGTATCCGTTGCTCTGCACCAGCGAGCTTATGAGCCCGCTACCCCGCTTTTTAATTGGTTTTGCCCTCCCG TTCTCGTACCAGACCTTCACGAACTCGTATCTT