

>tg1465 ADP-specific phosphofructokinase (pfkC)

>tg1465 ADP-specific phosphofructokinase (pfkC)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1375104 - 1377483 (Additional range around tg1465 is :500nt.)

>Thermococcus gammatolerans EJ3 CTCCCTCCCGGATATGTGAGAACGACCTTAACGGTGTGCTCGCCCGGCTCCGCGGGGGCGGTGAGTGTATAGGTCTCCGG GTGGTAGGGGTCAACTTCAATGCCCACGCTGTTCCCGGCGTTTCCATCGACGTAGGCCTTCAGGGTGCCCACGGCGGTGG TCCATCCATAGTTGTTCACCGTGACGTCTATGGTTGCTTTTCCGTTGCAGACGGTTTTATGCACCCTCATTCCCGTTATC ACGGGCCTCGGCATGTCCTGGATTAGGTCCGGCTTTGGCTGTGGCTCCAAAAGCGCAACGGTCCCCCACGCTCATGAGTA GGAGAAGGGCCACAGCCATCGACGTAACGGCTCTTCTTTTTCCCATGTTCATCACCTCAAAATTCAACAGGATAATTACG TGTACGTGCTTTTAAGATTTACCTGAACACGGGAGGTGATAACACTCCCCGAAACCCTTTTAAGATTTTGAACTTGCTAC TCACTGAGGGTGATACATA atgatggagctcctcgacgaggcaaggaagctatcgattttcacagcctacaacgctaac gttgatgcaatagtctatctcacgggtgagatagttcagggtctcatcgacgagttcggtgccgaggccgtcaggaggag aatggacgagtaccccagggagataaacgagccgatagacttcgtcgcgaggctcgttcacgccctcaagactggaaagc cgatggcggttcccctcgtcaacgaggagctccagagctggtttgatagccactttaagtacgacgttgagagaatcgga ggtcaggcgggaataatagcgaacctcttagccaacctcgacttcaggaaggtaatcgtttacacgccccacctcgcgag gagacaggcggagatgttcgtaccaaaaaagaatctcttctatcccgtagtcgagaacggaaagctcgttctgaagcatc cccacgaggcctaccgcgagaacgacccggtcaaggttaaccggatttttgagttccgcgcggggatgaggttcaagctt ggcgacgagacgattaccgtcccctattcgggccgcttcatagtttctgcccgcttcgagagcataagggtttacactag gccggagctgaagcccttcctttccgaaatcggcctccaggttgacggcgcaatcctctcgggctaccaggggataagac ttcgctattccgacggaaaggacgcgaactattatctaagggaggccaagaaggacatcctcctgctcaagcgtgagaag gacgtcaaggttcaccttgagttcgcctcgatacagagcagggaactcaggaagaaggtcatctacaacctcttcccgct cgtggacagcgttggcatggacgagtcggagatagcttacgtcctgagtgcccttggctactccaagctcgccgacagga tattcacttacaaccgcatcgaggacaccgtcttgggtggaaaaatcctcatagacgagatgaacctcgaagttctgcag attcacacgatttattacctcatgtacatcacccacgccgacaatccgttgagcgaggaggagctcaggaagagccttga gctggcgacgaccttagcggcggcgagggcctcgcttggcgacatccgctcgcccgaggacttcaaggttggcctgagtg tcccctacaacgagcgtggagagtacgtcaagctccgctttgaggaggccaagagacggctccgcacgagggagtacaag gttgtgataattccgacgaggctcgtggagaacccggtttcgacggtcggcctcggcgatacaatctcgacgggagcctt cacgagctacctcgcgttgttgaaggagaagggcgcgctc TGATGTTCTCTCGTTGTTTTGAAGACTTGTTCTTCGTTT TCTTCCTCCCCAGGTTCGCCCGCTCCGAGAAGGAATCCCTCAGGGCGCCGAAGAAGGTCTACCTAGTGGACACTGGCCTT GCCCTCTTCTCGCGTAAAGAGGCCGGAAGGGACATGGAAAACGCGGTCTTCCTTGAGCTACTCAGGAGGAAGCACTACAC CAATCCTCTCATCATGGGGATTCACTACTATGGCGGCTCCGGCGAGAAGGAGGTTGATTTCGTGGTTTCTGAATCCGGGA GGGTCGTTGAACTGATTCAGGTCACCCTAAGCCTCGAAGATGCCAGGGAACGCGAGATTTTGGCCCTTACCCGCGCGTCC AAAACGCTCAACTGCAAGAACCTCACCGTTGTGACCCTTGACGAAGAGGGCATCGTTGAGTCTGATGGGAGGAAGATAAG GGTCGTCCCCCTCTGGAAGTTCCTGCTTGGGGTTTGGCCTCGATAATTATTTAATTCAGTG