

>tg1466 hypothetical protein TGAM_1466

>tg1466 hypothetical protein TGAM_1466

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1376693 - 1380212 (Additional range around tg1466 is :500nt.)

>Thermococcus gammatolerans EJ3 CTCAACGTCGTACTTAAAGTGGCTATCAAACCAGCTCTGGAGCTCCTCGTTGACGAGGGGAACCGCCATCGGCTTTCCAG TCTTGAGGGCGTGAACGAGCCTCGCGACGAAGTCTATCGGCTCGTTTATCTCCCTGGGGTACTCGTCCATTCTCCTCCTG ACGGCCTCGGCACCGAACTCGTCGATGAGACCCTGAACTATCTCACCCGTGAGATAGACTATTGCATCAACGTTAGCGTT GTAGGCTGTGAAAATCGATAGCTTCCTTGCCTCGTCGAGGAGCTCCATCATTATGTATCACCCTCAGTGAGTAGCAAGTT CAAAATCTTAAAAGGGTTTCGGGGAGTGTTATCACCTCCCGTGTTCAGGTAAATCTTAAAAGCACGTACACGTAATTATC CTGTTGAATTTTGAGGTGATGAACATGGGAAAAAGAAGAGCCGTTACGTCGATGGCTGTGGCCCTTCTCCTACTCATGAG CGTGGGGGACCGTTGCGCTT ttggagccacagccaaagccggacctaatccaggacatgccgaggcccgtgataacggg aatgagggtgcataaaaccgtctgcaacggaaaagcaaccatagacgtcacggtgaacaactatggatggaccaccgccg tgggcaccctgaaggcctacgtcgatggaaacgccgggaacagcgtgggcattgaagttgacccctaccacccggagacc tatacactcaccgcccccgcggagccgggcgagcacaccgttaaggtcgttctcacatatccgggagggagtgattcaat gaacaaaacggtgacactcctcagggattcggactgcgagtacctcagcgatcaggaggaatacgattacggaacaaatc caaacgatccagacacggacgacgatggtgtcatagactccaaggatatgaacccccttggcgactacaggataaagatc tacatcctcagggcgagggcgctggacgacgttgacagcgctttggttggccacaaccccgcggacatgaaccttaccct cacagtaaacggacagacaaggacgctcttcctcacaaacgaccaggacgacaaggaaaataaaatcctcccaacagacg atcccctcctcaaccttgaggactacgcgatagccaaagccactttcgacgtcccggacgataaggttttcatcccgata actttccacctttatgacaaagagggcaataaaaagggagaggacattgacatctcccccggccccggaaccgttgcgag aataatgtacaacctcaaaaccggaacctggagcggcgacgattatccgggggacgaggagagatacttcggctacggcc acctgagcggctgcggcgacggctcgtgcggcgtttcttcccacgatccgaaaaaagacctcaaggtctacgtcaagtac gagagcatcctggaagagaaaggaatcaagggcgagatcctcaacatcacaaccatccaggatgtcaaagaagtcagggt agggggcggaaaaggagtgctttcaatatccaggccgggtagcgttaaaatagccacggtaaggctcgaaaacggcagtg tggttaacgtcaccctcgtcaacacctacaacgcgaaagtcctcagggtaaatccgataaagccaccccaagggccggac gcttctctggccagggaaaacacaaccaccgtggagttggtgggcacggctccggatgagccgttaaagggtgaagtcga gataatcccgatggaaggagacctcattgatcccggccttggggaagtcatcacgtactcctcaagggaggagcacgacg gggagatctggttcgtcatcgtgccggacgagccggacgggatacccttctggcgcgaggtcgagctcaacaaagagctg gaagccagcggaatctcagagaggttcgacccgagcgacggctattacctgctggagacaaattcgggggacttctggtc ctggcttgagcagtttttgaagtggacggacataaataacaaagagaaacttggggactacgatggcgacggtgttccga acgccgtcgaggtcttgatcgggaaggatccggcgaagagggatatactcggcattgagctcacggtgtcggtggagtgg gacatgagcgaggaggacaagaggaacttagcttacagcatcaggaaagcgagtgatttcgtctacgaccacacggacgg ctacgcgatgataaccagggttacgatctgggacgacaagaagaactgggataaggctgatgtgaggatctacaacacag gctggcaaattctaataataaatgatgaccactggccttcctcttggattggggcatactggaactccaccttgttcata gagatgcctagaagatttttcaggtactccacagattccaaaggcgaaatggggagtagtaagtggggtaagactttagg acatgagataggtcattatgttttctggttttgggatgagtatcaagactggaacaggcataaatataagacttggtata ctacacaaatggcactatattatcggggtgaaagtgcattcgatataagcagaattctctccgataaactcctaagcata catagcgttatgaataatgagtggaagtggagtgaactgagcacgccaggtgattacagtagttttaaagaggatgcaat atacatatggaggacttattcccacgcttggattgtggcaggatataaatcatgggagtacatgttgccagagcaatggg ggaacttaactcataaagacaaatggcactgttcatcgtgggaagcgctgtttaagttcttaacaggatatgataggcca gaatgggttagagggccatccgtagacatttgtatggatccgaatcttgatggctcttgcgacaaagcgcttccacaaga ttacactccaaaaaccggcccgtacactggtgttggctactttatggaggtggtttgggga TGAGGCGGAAGTTGTTTG CTCTCTTTCTTTTACTCACTCTCCTGCTCGGGTATTTGGCTTATTTGAACTCCCTCCCACTAGCAGTCAGAGCTTACAAA CTCGCAAGAATCCCCAGCGACGAACAGTTAATAGCAGTTTACCACGACAAGGACTTCTGGCAGTTCGCGACTTATAACGA GAAGACTAACACGCTCAAGCTTTACACGGTTGAGCAATCATCTCCCCTCTGGCTGAAGAGGAGGAATGTAGAGAGCGTAA AAGCGCTGGTAAACTACACTCCCTTAGCTTTAGACTTAAAACTTCTCAAGAGCTATGAACCACACAGTAAAGCACTCCTC TTCAAAACCCTCGGCTGGAAATACGAAGAAGACATCAGCGGCTCATACTGGGCAAACCTGAGCGAAGTCATCCGGCCGGG AGAAAAATATTATCGGATTTACGGGCTCGGGAGCAGTTCTGGACTGTGGATTAAGTCAAAAGCCGTGTGCAGAAAAACCA A