

>tg1469 hypothetical protein TGAM_1469

>tg1469 hypothetical protein TGAM_1469

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1381154 - 1383134 (Additional range around tg1469 is :500nt.)

>Thermococcus gammatolerans EJ3 ATGGGACTAGGGCCCGCATACTTTGGGTACAAGGGATTACTTCATCTACCTACAACTATGCATAATCCGAGTAGAGGAGT CATAGTAGAGTTCATCGCAAAAAACGATACAATTCATGTAGTTATTCACTATCCAAAAAACATGACATTTTCGACTATTT CAAGTGTCAGATTGAGAAAGGATTGGAACTCTACATGGAATCTAAAAGAAGTTCCACTCAGTGAAATCCTCCAAAAATCT AAATCCAAAGAACTTTCCCAAGAGATCAAAGGAAGTTTACGCTTTGAATTCTCTATTACCAAACGAGACAATAGAGCGGA AGCGTGGGCATCATGGATAAACTCTCGCAAACAGGCTCATGGTTACTGGAGGCTGTACCCACCAGACAAGATAGAGTGGA GAAGATTTACCTGCATTGAGAAAAGCTGTAGATGGACTGAAGAAAACATATTCGACCCATTTCCCTGAGAAGATACCCCC ACTAATACACGGAGGCCACG atgatgaaaaatacaaaactccttgctctctttgcattctttttgatcattcttttgct ctttgcttatgcttactctaaccagcccaacgaaaccatgagcagtctctaccaaaaaatcccagaacaagtgagagaga attcccagctaatagccgcttactactcttcacagaatggggacagagagtaccaattcacgttttacgatccaaaagag agaacactcagcatttacacgtttaaaatctccaaaatattgaaaatttggccgagaatgacagaagacaaaatcttctg caagaccccattcaactactcagtattagcaacaagcccagaaaagctaaaagacttcgaaaactgcaacaactgtcgac tattcttatacaaggacagaatttacaagaacgaagaaattgaggggatccaaccaagactctcggaagtgttaaaggtg aacgaaagctactggcgaattcaaatcctcggcgccagcgaactatcaacaggaaacataataggctcctctggcgatgc tggagaaatgtttggtctttcaggttatccgggattgttgattcttccggcagggaacaacgcgagtagaggggtaatca tcgcgattcaaccgttgaatgaaactcatgaggttattagaatacacttcccgctgaacgttacttttgaattcgtggag agacattatgacaacccagatttccccctctggagtttggagaacttgtccagtgctgttaagcgtttgcaggctttcaa aatcgagccgaaaccatggcgatgggagactacactaagcggcaaatacgccggaatagcatggttcacacaatcagggg cgtactatgaatacgaaatacatcctcagtcaaagtggatttataatggtgacttcacaatatcacggttcgagttcagg tgtaggagaggaggtgcatccccatactcatactactaccca TAACGGAGGTCGGAAGATGAAGGAACTTCTCGTAGTT TTAGTTTTTGTTTCAATCCTTTTGCTCTTTGCTTACGCTTACTCTAACCAGCCCAACGAAACCATGAGCAGTCTCTACCA GAAAATTCCAGAGCAAGTTAGGGAAAATTCGCAGTTGATAGCGGCTTATTACTCGTCCCAAACAGGCTTTGGCGGCTTTA GAGAGTATCAATTCGCCCTCTACAATCCAAACGATCGAACAATCAGCATTTACACGTTCAAAATCTCCAAACTCCTGAAA ATCTGGCCGAGAATAACGGAAAACAAAATAACCTGTAAAACCCAGCTTAACTACTCCATCCTAGCCACCAGCCCAGAAAA ACTCAAAAACTTCAAAAACTGCGGCAATTGCAGAATACTCCTCTACAAGGACAGGATTTACAAGAATGGGGAAATCGAGA GCATTTACCCGTCAATCGAACAGGTAATCCGGGGCAAGGAGAACACTACTTACGTGAAACTC