

>tg1470 hypothetical protein TGAM_1470

>tg1470 hypothetical protein TGAM_1470

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1382151 - 1384161 (Additional range around tg1470 is :500nt.)

>Thermococcus gammatolerans EJ3 CGAACTATCAACAGGAAACATAATAGGCTCCTCTGGCGATGCTGGAGAAATGTTTGGTCTTTCAGGTTATCCGGGATTGT TGATTCTTCCGGCAGGGAACAACGCGAGTAGAGGGGTAATCATCGCGATTCAACCGTTGAATGAAACTCATGAGGTTATT AGAATACACTTCCCGCTGAACGTTACTTTTGAATTCGTGGAGAGACATTATGACAACCCAGATTTCCCCCTCTGGAGTTT GGAGAACTTGTCCAGTGCTGTTAAGCGTTTGCAGGCTTTCAAAATCGAGCCGAAACCATGGCGATGGGAGACTACACTAA GCGGCAAATACGCCGGAATAGCATGGTTCACACAATCAGGGGCGTACTATGAATACGAAATACATCCTCAGTCAAAGTGG ATTTATAATGGTGACTTCACAATATCACGGTTCGAGTTCAGGTGTAGGAGAGGAGGTGCATCCCCATACTCATACTACTA CCCATAACGGAGGTCGGAAG atgaaggaacttctcgtagttttagtttttgtttcaatccttttgctctttgcttacgc ttactctaaccagcccaacgaaaccatgagcagtctctaccagaaaattccagagcaagttagggaaaattcgcagttga tagcggcttattactcgtcccaaacaggctttggcggctttagagagtatcaattcgccctctacaatccaaacgatcga acaatcagcatttacacgttcaaaatctccaaactcctgaaaatctggccgagaataacggaaaacaaaataacctgtaa aacccagcttaactactccatcctagccaccagcccagaaaaactcaaaaacttcaaaaactgcggcaattgcagaatac tcctctacaaggacaggatttacaagaatggggaaatcgagagcatttacccgtcaatcgaacaggtaatccggggcaag gagaacactacttacgtgaaactctccctcctcaaagactcagaaatcaccactggagcagtagggttcgtcattggaga catgggattctacactgatgatgtttattatgggaggggtttgctttatttgcccagtcctattgtgaatctcacgaggg gtgttgtggttgaattcctgccagtggacaacgagaccattaagagggtaattcactacccgggcaacgttaccctctcc gacgagttcaaaatcacaaaatactacagggttaacatcacgcggaacttgacttggacgttaaaggaagttccaatcga gcagattcttcaaaaactcgactctaaacagctccaaaaaaccattggagaggactcgagagttaggctcgaaatatcca aggaacccttatgggccaaaacaccaaaactcgaagcctggctaatatggatagacaaagggaaaactgtgtatatagaa aaacgaatatatcccactgaaaaaacttacaaggaaaaattcagcttcatcagtggttattactgcggctgg TAGAGGT GAAAAAATGAGATCCTTCCTTGCTTTCCTCCTTGTTTTCCTCCTTTCCTTCCTTGCTTACAATGCTTACACTTACCACCA GCTCTCCTCAGCGGAAGGAGCTTACAAGTTAGCAGGAATTCCAAGCAGTGAAAAGCTCATTGCGGTCTATCATGATGAGA ACTTCTGGCAGTTCGCCACCTACAACCCGAAAGCCCGAGAACTCAAAGTCTATTACGTTGGTCAGGATTTTCCTCTGCTC TTCAGGATAAAGAAAACAAAAACCGTGAAGACACCATTAAACTACTCCCCACTCGCTCTTGACTTGAAACTCCTCGAAAA AGCTCCAAAAGAAACTCCTGCATTACTCTTCGCCGGAAAATGGTACACTAAAGAAAACCCACCAGAATTCCCAACAGTAG AGCAAATACTCCAACAATACAACAACAAAACAATGAGGAGATTGAGTGCTTATTATGCCGAAAAAGAACTCTGGATTGGG GCAATAACCATG