

>tg1477 hypothetical protein TGAM_1477

>tg1477 hypothetical protein TGAM_1477

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1389080 - 1391048 (Additional range around tg1477 is :500nt.)

>Thermococcus gammatolerans EJ3 TAAAAATGGCTTCTGGGTGGGGCTAGATGAGATAAAATCCTGTGGAGGAGACTACTCTTTCCCACCCGCTGGGCCTGGAG GCATTTTAGTTCCTCCAGAGTTGTCAGACAAAAATCTCCCGACAGTCATAGAGATTACGTGGAACTCCCCCTACGGCTCA GAAAGAGCATTGGTGTTTTTTAATGGAGCCATAATTAAAGCCCATACAACAAAACCCCTTACCTGTCCGTTCGAACTTCG AAACCTTACCGGCGCTTTGAGAATCTGGAGGGAATACTTTGAATACAACCCCAATAGAATGGCACTGTGGGTTTCCCGTC CCCTTGATACTTCGTCTAAGGAGTGCACCAACAAAACAACATGGGTCATCATTGCCCTCCGTAATGGGGATTGTGGAAAC GAATGGTGGGGAAAACTTGAGGACACATGATGCCAAAAGATGTTAATCCAAAAACCGGCCCCTACACCGGCGTTGGCTAC TTCCTGGAGGTGGTCCGAGG atgaggaaactcctcgccatcttgggttttctttttgtgggttttctcttactctttgc ctacgcttactctgaccagcctcatgagactatgagcactctctaccaaaaaatcccagagcaagttagagaaaactccc aactcatcgcagcttactactcttcacagaatggggacagagagtaccagttcgcgttttataatcaaaaaaaccagacg ctcagcatttacacgttcagtatttcaaacttcctcaaaatcttctgggacgaagagaaaaacaaaataacctgcaagac cccattcaactactccatactagccactagccctgaaaagttaaaagacttcacaaactgcgacaattgtagaatactcc tctacaagggcaagatttacaggaatgaggagattgaggagattcaaccaagactttcggaagtgttaaaggcaaacgaa agctactggcaggttgaaatcctcggcgccagcgaactatcaacaggagacataataggttcctctggcgatgctggaag aatatttggtctttcagggtacccaggattgctgattctcccagctggcgataacgcaagcagaggagtaaccatcacag tccagcctttcaacaaaactaaggacgttgtcaaaatacactttccactcaacattacttttaagttcaagcaaaggcat tatagcgacagttatgattactctccttggagtttggagaacttgtccagtgctgtgaagcgtttgcaggcttttaagat tgaaccaaaaccatggcgctgggaggccacactcagcggggaatacgcaggaatagcatggttcacacaatccggaagat actaccaatacaaaatctacccacagatagaatgggaggatagaggacactcccagttgtctgttcacgtcagatgccgg agtggaggatgggtgcccttccgctatccc TAACGACTAAAGACCACAAAACAAAGGGGGCATAAAATGAGGGCTCTAA CGGTCTTTGGATTCTTTTTAATCATCCTTTTACTCTTTGCATACGCTTACTCTAACCAGCCTCATGAGACTATGAGCACT CTCTACCAGAAGATTCCAGAAGAGGTTAGAGAGAACGCACAGCTAATAGCGGCCTACTACTCCTCACAGAATGGGGACAG AGAGTACCAATTCGCGTTTTACGATCCAAAAGAGAGAACACTCAGCATTTACACGTTTAAAATCATCACTCTCTTCAAAA TCACCTTGAATGAAAAAAAGAGCAGAATATCCTGCAAGACTCCATTCAACTACTCCATCCTGGCCACCAGCCCGGAAAAA CTCAAAAACTTCACAAACTGTGACAACTGCAGAATACTCCTCTACAAAGACAAGATTTACAAGAACGAGGAAATCGAGAG CATTTACCCGTCAATTGAGGAGATGATCCGAGGCAAAGAGAACACCACTT