

>tg1505 hypothetical protein TGAM_1505

>tg1505 hypothetical protein TGAM_1505

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1410937 - 1413373 (Additional range around tg1505 is :500nt.)

>Thermococcus gammatolerans EJ3 TGGATCTGGGTCCTATAAAGTAAGGGCGACCAAGGAGGGTTATGAGGATTACGTGATAACAGTTGAGTTGAAGGCTGGTG AGTCCAAAGAAATCACGGCTCAATTAAAAGAAAAATCCACAACTACGACAACCACAACAACGGTCGCTACTTCTACGTCG GCCGGCGAGACTACAACGACAGCCACGTCGAACGGTAGTGGAACGACTAAAACAACCTCTCCAAAGGAAGGTGGTGGAAT ATGCGGACCGGCACTGGTTATTGCCCTAGCCTTAGTTCCCATCCTCCACAGAAAACGCAAACACAGGTAAAAACCCTTGA AACTCCATGAATCCCTGACGAAGAACTTCCTCCCTCACGTTTTCTCCCTTTTCCTTTCCCATGTGTCTCGATATTGAGGG TATGAGACACTTTTTGGTGAATGCGGGTATACTCTTACTTGGGTCGTAGCCTCCGTAAGTTTAAAATAACTTTAGGCCCA CCTAAAGAGGGGGTGAGGGA atggttccgctgaagaggattgacaaaatccgctgggagattcccaagttcgacaggag gatgcgcgttccgggcagggtttacgctgacgaccagctcatcgagaagatgcgtcaggacaggactctggagcaggccg ccaacgtcgccatgctcccgggcatctacaagtactcaatcgtcatgcctgatggacaccagggctacggcttcccgatt ggaggcgtcgcggcctttgacgtgaaggagggcgtcataagccccggaggcgtcggatacgacattaactgcggcgtcag actgattagaacgaatttaacggaaaaagaagtcagaccacgcatcaaggagctcgttgacacgctcttcaaaaacgtcc cgagcggacttggaagcaagggaagggtgaggctccactggacccagctcgacgacgtcttagcgaacggcgccaagtgg gctgttgacaacggctacggctggaaggaggatttggagcaccttgaggaaggcggaaggatggaaggggccgacccgaa cgccgtcagccagagggcgaagcagaggggagcgccacagctcggctccctcggttccggaaaccacttcctcgaggtcc aggtcgtcgataagatattcgatgaggagatagccaaggcgtacggcctcttcgaggggcaggttgtggtaatggttcac accggttcgcgcggtctcggccatcaggtggcgagcgactacctcaggataatggagaaggccaacaggaagtatggaat cccctggcccgaccgcgagctggtgagcgttcccttccagagcgaagaaggccagaggtacttcagcgcgatgaaagctg ccgcgaacttcgcctgggccaacagacagatgataacccactgggtcagggagagctttgaggaggtcttcaagaggaaa gcagaggacatggagatgcacatcgtctacgacgtggcccacaacatagcgaaggttgaggagcacgaagttgatggaaa gaaggtcaaggtcgtcgtccacaggaagggagcgacgagggccttccctgcaggccacccggacgtgccgagagcctacc gcgacgtcggccagcccgtccttattccgggctcgatgggaacggcgagctacattctggccggagcagagggttcaatg aaggaaaccttcggttcgagctgtcacggcgccggaaggctcctaagcagaaaagccgcaacgaggaggtaccgcggtga cagactgagaagcgagctccttcagagggggatctacgtccgcgcggcctcgctccgcgttgtggccgaagaagctcccg gagcctacaagagcgtcgataacgtcgtcaacgtcgtccaccaggctggcatagcaaagctcgtcgcgaggatgcgcccg atgggcgtcgccaagggc TGATGCCTTCGGTCTTCTTTTGATTTTGTTTTTGAGTGAAGTCAGCAGTTCTTAAACTTGA AAAAACTCGAATTTCGTTCTTTTCCAGTCCCTGCAAAAAGTTATTGCGACAATATGCTTGTCCTCCATTGTAAACTCTAA ATAGTGCCATTTTTCTAATATTTTTTCTTTTGGGATGCCGTATCTTTTGCTTAATTCTTCGAGTTTCTTTTCGTACTCTT CTCGCTCGTTTCTCTCGTCCGCTTTTTCTTCTTCCCTCCGAAGATGAACATCCCTGCCAACGGCAAAAGCGACAAGGACA TCACCCATCAAACTTCGCCTTCATGGGAGATAAGCCTTTCGAAGCTTAAAGGCCGGCACTGGCTATCTCCTCAAGCTCCC TCAGCCGCCTCTGGAAGAGCCTCTCCTCGAAGACCCCAAAGCCCACGTAGTTGGAGATTATCGCCTGGATATCGTTCTTG TACGGGCTGTCTTCGAGAACCCGATAAATGGCGGTTGG