

>tg1518 MoxR associated protein, containing DUF58 domain

>tg1518 MoxR associated protein, containing DUF58 domain

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1423039 - 1425283 (Additional range around tg1518 is :500nt.)

>Thermococcus gammatolerans EJ3 TTCATTGAGCGGAAATTTCTCGCGTTCCTTCTCGTTGGAGCCGTTTTTTCGTTCCTGCTTGCGTACCCGAATCCCAGGGG AGCACTGCGTTTCTTGCTCCTGCTGACCATGAGCGGATTAATCCTCTACTTGGCCTACGCCGTCTCCACATACATCTCCA CTCACCTGGGCAAGAAGTCCCGGGTTGAACCACTCCCCCTGCCGTCCGGAAGCGTTCGTGAGGACTACTACTCAAGGGAG CTTAGGAGGGTCGTTGAGGCGTTCGTTGAGAAGGGAGACAAGGTTCCTCTAACGGTCTTTTTAATCCGAAATGCTCCGGA GGGCCTCGCCGAGGTTCAGCTCCGTGAAATCGTGAGGCCAATAGTGGATTACACTCCCCCCAGCCCTTCGCCCCTCCTTC CTCCCTGGGTGGTTGAAAAGAAGCTTGCCGATGAGAAACTCAGACGGCTTGAGGTTCTCAGGGACACCCTTAGAAAGCTC GGCTTTTCGGGGGTTGACTC atgaggcggatggacgtcctgctgttcgcgacccttgcgccgttctcactcgcgctgtt caccggggttctcggtctggcatacgcaagcctaattccggcatcaatccttgcgtactccctcatgtctgaccccccgt caggttttcacgttgaaagaactgtggaagcgcgaaaccttgccgtgggccggcgcgccagggttcgcgttaagctcacc gttgagcggggcgctggtttggtgttcatcggggacgttgtctctcccgggcttaaggttcacggccgaaaccgcagggt tttcgtaaagctcccaggcgaggttcttcaggtcgagtattcctatgaggtctcccccggaaagaggggcgttcactcaa tatcccctgtggaggtcataagtcaagatttccttggaattcttagaaagaactacgggatattcggagacgaggttacg atagaggccagaccggtcattggtagtctcagggcgagttccctgcggagtattcgggctaaaaggcgtggtctgccagt ggttctctcccgtaagggtatatcctccaaggactttaaggagattagggagtatcagcccggtgaccccctaaaagcaa tcaactggaaggcaaccgcccgctttggggttcccctcgtcaacgagtacgagcccgagggtatggcaaccgtcatggtg tacgcggatacgacgaccgatatgggaactggggacgtcttcaacggggccctcgaaagcgcccttggcctgtcgctctc cctcgtccacaccctcctcaaggcaaacctgagggtcggcctttatctggcgggctctaaaaggttcgtaacgcccagaa ctggaactcaggcattttcaagcttccttagggctgtcctctccgccggcccgtctccgaaccccgaaccgatgcccctt gcagtggagcgttcaaaaagagctggaaaagttgacctcgcgataatcataaccaacatcaccccctacaacgtctcgga gctgagagacgccattggaaagctcaggaaaacctttaactgcagggttcttctcgtggacgtcaatccatacggggcga ttgataaggaggtcatgcaactttcccgtctccacaagcgaaaactggcggggaagctcggcgtgcccgtggtggagtgg gttccctctcgggagggtccaagcacggccctgaaaaaaatcctcgggggtgtctcccttgccctt TAGGGTCTCAAAG AATTCACTCAAGCTCGCGGTTCTGGTCTCACTGCTCCCACTGGCATGGCTGGCTTCGCTGACGGACGTCCTCAGGTTCCT CTCAGGGGCTATCGAAGCACGGTTGGGAATCCCAGTTCCTCCCCTGCTCTTGGGAATCGTTCTCGTTATCGTTCCCGTGC TTATCTACGTTTACATGACCGGAGACCTCCTCAAGCCGTTCCTTTTGGCGCTGGCCCTGTACCTTTTGCCCTCAATCTTT GGGATAGACTTTAACCTGCTCGACAGGTATGTACCCGGAGCAATCGGACTGTTTACGGGTTTCCTAGTGGCACTTTTTAT CACATGGCTCGAGCGGGACGTTGGTTTTGTTGGGGGTGATGAAAGTGAAAGGCTCCTCATCTCGTCCCTCCGTGAGGTTC TCGTCCCCATGCCCCTCGGAATAATGCTGACGGCCCTGCTCCTGTGGCGCAGTTCCCTCGGAAAGAATCCGCGGAACGTC CTTCCC