

>tg1520 Adenosylhomocysteinase (ahcY)

>tg1520 Adenosylhomocysteinase (ahcY)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1425132 - 1427394 (Additional range around tg1520 is :500nt.)

>Thermococcus gammatolerans EJ3 GGCACCTCAGCGGTCAGGAGAATAGTGTGAACCGTATCGTCGCCAATGCTCATCGCGTCGGTGCCGACCGCTTTAGCACC CTCGGCCACAAGGAAGAGCGCGACCTCGGGTGAGAGCTCCCTCCCGCCGGTAAGGAAAAGGACGATTTTCCCGTAATAGC CCGAGTCGGGAATCTCATCGAGCTTAACGGTTCCCTCCCCGTCGCGTACATCAACGACAAAGGCCTCGCCGATGAACTTC TCAAGGGGCATCTCGTCTATCGTCTTTCCGCCGGGAATGAAGTGAGCCGGAGCGTCAACGTGCGTCCCGGAGTGCTCTCC GAGTTTAAGGGCGTTCATGTAGTAGCCGTCGCGCTCGATGAAGGCCCAGGGTTTGACCTTCACCTCGGGGTCGCCCGGAT AAACCGGCGTCTCCTCTCCGAGGGGAAGCGAGAGGTCGACTATCATGACAACACCAACCCTTTTTAACTCACGGAATTAA AAACCCATCGGTGGTTGTT atggactgcacgaaggattactgcattaaggacataaacctggcaccgagcggggagaag aagattgactgggtctcgcgcttcatgcccgtcctccagatgataaggggggagttcgagagggagaagccctttaaggg cgtcagaatcgccacgacgctccaccttgagatgaagacggccttcctgctcctgacccttaaggcaggaggagctgagg tctcggccgcggccagcaatcctctctcgacgcaggacgacgtggtcgcggccctggcaaaggccggcgtcaaggtctac gcgattagaggagagagcagggaggagtactacgagaacatgcacagggctttggacataaggcccaacatcatcataga cgatggtgccgatatgataagcaccgtacaccgcgaaaggcctgagttaatagacgaaatctggggcgcaagcgaggaaa cgaccaccggggtaataaggctccgcgcgatggagaaggacggggttctgaagttcccaatcatagcggtcaacgacagc tataccaaatacctcttcgacaaccgctacggaacgggacagtcaacgtgggacggcataataagaaccaccaacctgct cgtcgccggaaagaacgtcgtcgttgtcggctacggctggtgcggaaggggaatagcgatgcgcgcttgcggtctcggcg cgacggtgatagtcgtcgaggttgacccgattagggccctggaggcgaggatggacggcttcctcgttatggacatgaag gaggcggcaaaggtaggcgacatcttcgtcacctctacgggcaacatcaagtgcattcgcagggagcacttcgagctcat gaaggacggcgtcataatggccaacgccggccacttcgacgtcgagatatggaagcccgaccttgaggagctcgccgttg agataagcgagccgaggcccaacatcagggagtacaagcttaaggacggaaggaggctctacctcttggcagatggaagg ctcgttaatttagcggcggcagacggccacccggcggagattatggacatgagctttgccctgcaggccaaagcggcgca gtacatcaaggagaaccatgagaagcttgagccaaaggtctacgtcctgccgagggagattgacgagatggttgcgagga ttaagctgaacgcgatgggaataaagattgaggagctcaccgaggagcagaagaaatacctggagagctgggagcacggg acg TAGGGAGGTAAATGAAATACGTTTCCTCCCCCTTTCTTAACTCCTCGGTCTTCAGCAGAGTTTGCGTATCCCAGGG GGACATTAGAACGACCACCTCCGGAACTTCATCGTCCCACTCAAGTTTGAGGAGTATCGGCCTTTCAACTGGAAACCCTC CGGACAGAGTGAAAGTAACGCTCCTTTCCGTCCTTTCCAACACGTCGAGAATGAAGGAATCACCGGCCTTCATAACTGTG CGGAGAATTAGGTACGACTTTTTAGCGGGCTGTACGTGATCATTCTGCCCCTCTTTAAAGTGAATCACAAGAACAACGGC AGCGAAGAGCAGAAGTGGGAGCAGAAAAGCCAGGGGAAGGACGTTCCGCGGATTCTTTCCGAGGGAACTGCGCCACAGGA GCAGGGCCGTCAGCATTATTCCGAGGGGCATGGGGACGAGAACCTCACGGAGGGACGAGATGAGGAGCCTTTCACTTTCA TCACCCCCAACAAAACCAACGTCC