

>tg1529 Chemotaxis histidine kinase (cheA)

>tg1529 Chemotaxis histidine kinase (cheA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1433705 - 1436933 (Additional range around tg1529 is :500nt.)

>Thermococcus gammatolerans EJ3 CACACAAGGGTTTTAGTTTACGAAAAACACAGTTTAGAGGGAGGAACGATGGCGCGAATACTGATAGTGGATGACGCGCT CTTCGCGAGGATACTGCTCAGGAAAATATTCACAGAGGCCGGGCATGAGGTAGTTGGTGAGGCATCCACTGGTAAGGAAG CGATTGAACTCTACTCAAAGCTCCGCCCCGATGTTATAACACTTGATATAATAATGCCGGACATGGACGGTATAACTGCC CTGCAGGAGATAAAGAAAATTGATCCCAATGCCAAAGTTATCATGATAACCTCTGTGGATAATGATAAGAAACTTATAGA GTGCATAGAAGCCGGGGCCTCCGGATATATAGTCAAGCCCTTTGAACCCTCACAGGTGCTCAAAGAAGTCGAGAGAGTAC TATCGAGCCAGGAATAGGTGGCCGGCCGGGGTAGGGAGGCTGGAAAGAGCTAGAGATTCACTGTCTCAGAGGTGCACTAC CCGGCCGGCCTTTACGGGG gtgaccatcatcggggcaaactatatcgggagtttcctggaagaagcaagagaaaaggtt gtggagctcaaagagcttttttcccggcttagtggtgatgaggaaaatctttcaaagaccgtcgaggaaatgatacggag tgcccacacgattaagggcacggcttccttggctgggtttccaaagcttacccaggctgcgcactggctcgagacgattc tggatatgatccgctcgggtaacctttccctggacgaggaccttctctccataattcgggagctaatagtctcaattgac cggctgatacattccattgaggactttggggacgagagggaagttgaactgtcgcctgtgatagctagggcaacccttta tcttaaaaacgcctcgagaaaagctggaaagctcccccctttgaaggttgccctggagaaaaggtacgaggttgttgtga gctttgagcctgtttccgagaagatccctgtgtggacctttgcggttctttccaaactgcagagactgggtcacctgata tcttcagagccggacgttaatgatattatcgagggccggactaagccgggagaacggcttaaacttgttattgagagtcc attaagcccagatgaaatcaaggaagagctcggttccgtgaacggtgtcagaaaagtggaggtgcttgggcatggaggac aaaacgaaagaaaagaaggaaagctcaggctcaggatttaccttacagaggagactccttttaaggctgcacgggcgctt cttatcatccaagacctcaggaaggcgggtagggtactgtcggtgaatcccccagagggggagataaaagatggtatgct gcttggtgagagtttctttgaggtacttttggaaagcgagctgtcattcgagagagtcagggagttagttcttcgccacc cgggggttcgagatgttattaagatcggggagccggaaggggagtccacggaacggaaatcgttctcgggtaaaaaaatc aggccattacccttcaggtcacggaagagaactattcccgttgatgtttcagctctggacgagcttctttactctctagg tgagcttgtagcgattggagaatggttgagagatataacctctggcagtttcaatcccgagcagatagaggagctgagcg gtaaacttttggaaaccatcgagaggctgaggaagacggttacttcccttcggactgtcaaactcagggacaggatagca gagctgataccttctatcgaaaagctggcagcggagaaaggaaagcgggttaaagttactatcctgggagaggacgtcgc cgtcgataggatggtggccgccgtcgtatgggaggcactcgtgcacatacttagaaacgccgttattcacggtattgagg ggagtgaagaaaggctcagaattggaaagccccctgaggggctcatcgagataagcatcgttcctcatccgagctacgtt gaggtcagcgttcgcgatgacgggaggggaatcgacatcagtgaggtcaagaaacgagctgtagagaggggcataataac accggaagaagccaagaggctctctaggaaggaagcgcttatgctgatatttaagccgggaatgagcacggagagggaag tttctgaggagagcggaaggggctttggtctgagcgtggttatggagtcgataagggaactccacggtagcgttcacgta agcagtgaggagggtagaggtaccgtaataacgctgagggttccgaccgacgtgctgatcattcctgtttacatcgtcga ggttggagggaagaaatatgcaattccctccatagggattctcgatagtttcaagctcggggctgagagcgtgaggaagg tgggaagtgtctacgtcgcggcccacacctcaggaattttcccggcagttcttctccacgacattgtcgaggactttgct ccactgcccgagggtgaggtcgagggacttctgtttcagtttgataaggatggtaaggagaaggtgctcgtgctcgttga tcggattcttggaaagaaggagaccgtcgttaggtcccttcgctcgctggttccttccgctgaggtagagaagagtgttt tcaccggagtgataatcatgggaggcagggagccggttccgcttatagacttgatcagccttatggagggattagtgtgt gaaaaacgt TAGGCTTGTGGGACGACTGCTTGAGAGAGCCCTAAGGGAGTCGCTCGCCAAAATCGACCCAACTGGCAAG ATGGAACTCTCGGAGTTTCGGGTGATCTCGTCCTCCGACTTGGTTATTGGGGGCCTCTTGGAGGGCGTGAACTTCGTGGG CTTTGCCATAGGCGATAGCCCGGAGCTAATAATGGCCTTCGATTTTGAGAACTCTTCCACCATCGTGAGTCGCCTTCTAA AACTGAAAAAGACGGGGATTCTCGAGACTTACAACATTAGGGAGCTTATGGAGTCCCTTCTCAGGGAACTGGGTAACGTC ATAGCCGGCCAATTTGCCAGCAGGCTTTCGAACTCCCTGGGTTACGAACTCCTCCCCAGCGTTCCCTTTTCCATAAAAAC AGTTGATCAGCTTGAGAGGGTTCTGAACTTTCTCGGTGGGGGAAAGAAGCTCCCCGTGTTTGTGGGGCTTGTTTACGATG AACACGGGGGCTGTCTTGAGGTTTACATAA