

>tg1542 Flagella-related protein I, type II/IV secretion system protein E (flaI)

>tg1542 Flagella-related protein I, type II/IV secretion system protein E (flaI)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1444534 - 1447168 (Additional range around tg1542 is :500nt.)

>Thermococcus gammatolerans EJ3 TGAGTACATAAAGCAGATGACTTCCCTTGGATATGATATAATCCCTTTTCTAATCAGGAAGAAGCTCGTTTTTGTGTCGC TCTACCCCCTTCTGAGCGGGGTTAGCGAGAAGAGGAAGTTTCTGAGCAGACTTCTTGGCGAGCCCCGTCTCTGGGAGCCG AACGTCATGATCATCGATTCATTTTCATCTCTCCTCTCGAGGGAACAGGAACCGAACGCGATCCGGGACTTCCTGCTCTA CGTGAAGAAACTGGCCTCCCTTGACAAAGTTATAATACTGACAGCCAACACCGAGGAAATTGATAGGGATTCGCTTTTCG TCCTTGAAGAGGCCGCGACTCTCCTGATAAGATTGAACGTTAAGGTGTTCGGAGGAGATCTCAAGAATTCTGCGATGATA GTGAAGTACAACAACGCCAAGGGCATCTTTCAGAAGATAATCCCGTTCCGCGTGGAGCCTAAGGTGGGGCTGATAGTAGA GATCGCGGCGGTGGTGTGAT atggcgcaggtaatcaagagtgacacgctggaagaggcaatgcaaaggaacccccacct taggaggtacgtggagagcttccgaaagaagtacggtaagatgccagagtttcacgcccagctcagcagggacatgaagg atataatgtaccccaacataatctatccagtcggtgatcccatcttcatccacatctacggcgaccagaaaactgacaag aagtacatcgtcatagaacctagaatagaaacccctattgaggagaagaagtacgagatgataaaagatcgcatcctcga aatcgctcccaccagaaacatccccgaggatcaggaggagtttgagaggtttctcgatgctctctacgatgaagccgtgc tgtcattagtcaaggggaaaaggaaaattccgggaacgaaggaaccgttcaccttaaccaaggaagaaatggaaaagttc cgctacctcatcaagcgagatatcataggaatcggcccccttgagcccctagccagggatccatacattgaggacataca tatcatcggcgccaactacgtctccctggttcacaagatattcgaggccctgccaactaacataacattcggtgacaacg tcaagctggcggactacttcaagaacatagccgaacgcattggaaggcccgttagcgacagaaacccgatagtggacgga gccctcccggacggttcacgtatcaacataatctactcaccggacatctccctcaagggaccgagcgctacaattcgtaa gttcacggcaacacccatcagcatcgtccagctcatagggtggggaacgctgagcgcggaagtagcggcctacctgtgga tagctcttgagtacggaatgagtgtcttcgtatgcggcgagacagcaagcggtaagactaccctgctgaactccataatc cccttcatcaagccaggctcaaagatattcaccgcggaggacactcctgaggttcaggttccccatccaacatggcaaag gcttgtaacccgtgagcgcggcccggaggagagcagggtaacgctcttcgaccttctcaaggcggccctgcgttccaggc cgaactacatcatcgtcggtgagattcgtggtgccgagggagcgatagcattccaggcaatgcagaccggccacccggtt atgagcacatttcacgccggtgacgtcaagaagatgatacagcgttttaccggtcatccaataaacgtcccgataacctt catcgacaacctcaatatagcggtcttccagcaggcagtttatctaaagggtaagttcctgaggagaaccgtgagtgtcg tcgagatagagggctactacgaagagctcggcggtgttgcaacgaggaacgtcttcgagtgggacccagtaaatgacaaa catatcttcaggggtttcaacaactcttacatcctcgagagaaagatagctgagatagccggttatgaggatccaaagga gatatacaacgagcttttcctccgtgcgaggatccttcagagaatgctggagcttggcatcacgaactactgggatgtct accgggagatcaaggccttctaccagcgaggtatcgagggcctgagcttcaggctc TGAGGTGATAGCCATGCCCGACA AGGAGAAGATCAGCATCTTCACCAAGGCAGACCTCGACATGAAAACGTACATTCGCAAGATCCTCCTCCCGAACGTGGTT ATCTCAGCGGTTCTCTTCATCGTTGCGTCCATAATCTCACGGCTCTTCATGCTCTCATCTGCCCTGACAACGATGCTCTA TGCCATTCCCGTTGTTCTATTGGTCTACGCGGCAATCTATCCATATATCCAGGCCGATTCAAAAAAGATTTCGATAAACT CTCGCATCCCCTACTTCATAACTTACTTCGCAGTTCTCTCAACGAGCGAGATGGGAAGGTCCGACCTCATTAAGGTACTG GCCAGCGATCCAAAACTCGGCGCCATAGCGAGCGAGCTGAAAAAGGTCTACATAATCGTTGATAAACTCCACCGTTCAAT GCCGGAAGCTTTTCGCTTCCTCGCCAGAAGAACACCCAGCAAGGTCTTCGCGGACTTCCTTGACAGGTTGGCTTAT