

>tg1543 Flagella-related protein J, type II secretion system protein F (flaJ)

>tg1543 Flagella-related protein J, type II secretion system protein F (flaJ)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1446182 - 1448909 (Additional range around tg1543 is :500nt.)

>Thermococcus gammatolerans EJ3 ATTCCAGGCAATGCAGACCGGCCACCCGGTTATGAGCACATTTCACGCCGGTGACGTCAAGAAGATGATACAGCGTTTTA CCGGTCATCCAATAAACGTCCCGATAACCTTCATCGACAACCTCAATATAGCGGTCTTCCAGCAGGCAGTTTATCTAAAG GGTAAGTTCCTGAGGAGAACCGTGAGTGTCGTCGAGATAGAGGGCTACTACGAAGAGCTCGGCGGTGTTGCAACGAGGAA CGTCTTCGAGTGGGACCCAGTAAATGACAAACATATCTTCAGGGGTTTCAACAACTCTTACATCCTCGAGAGAAAGATAG CTGAGATAGCCGGTTATGAGGATCCAAAGGAGATATACAACGAGCTTTTCCTCCGTGCGAGGATCCTTCAGAGAATGCTG GAGCTTGGCATCACGAACTACTGGGATGTCTACCGGGAGATCAAGGCCTTCTACCAGCGAGGTATCGAGGGCCTGAGCTT CAGGCTCTGAGGTGATAGCC atgcccgacaaggagaagatcagcatcttcaccaaggcagacctcgacatgaaaacgta cattcgcaagatcctcctcccgaacgtggttatctcagcggttctcttcatcgttgcgtccataatctcacggctcttca tgctctcatctgccctgacaacgatgctctatgccattcccgttgttctattggtctacgcggcaatctatccatatatc caggccgattcaaaaaagatttcgataaactctcgcatcccctacttcataacttacttcgcagttctctcaacgagcga gatgggaaggtccgacctcattaaggtactggccagcgatccaaaactcggcgccatagcgagcgagctgaaaaaggtct acataatcgttgataaactccaccgttcaatgccggaagcttttcgcttcctcgccagaagaacacccagcaaggtcttc gcggacttccttgacaggttggcttattccctcgacagcggtgtggacatgaaggaatacctctttcaggagcagaaaac cgttatggacgactacgagactttttacgagggggccctctacgatctggatgtattcaaagagatatacgaatcaataa ttatctcagttgttttcatggcgagcttcatcattataggcccgttgataacgggccaagacatcggaaggctggcgctc tacaccctcgcaataatcctggcggccgagataggtgtctttcttgtcataaagtttagaatgccggaggatcccatctg ggcagacaccaagggaatagaaacggaaagaatgaagaggattaaaagggccagccagatttcagttcttggcgtcgtcc tgatggggatactctactacttcctcctcagcaagaggtttgatatacctaagccctttgtcgttgccctgatcttaagc cccctttactacgttggccgtctcgcggcaaaggaggagcagtcgatattcagaaaggacgagaacttcgccgcctttat aagaagcctcagctcttccttagccgccagcggaacctccctcgtcctcgtccttaagtacctcagcgcccacgactttg gatcgctgaccgaggacatcagggccctgtacagaagactagccgttagggtagatagggagagggcatgggacttcttc atagccgggacgggaagctggctgatcggcattttctcagagatattcagggaggcaataagactcggagcagagcccga ttacgtcggtctcgtcatcagcagaaactttgagcgccttgtacgcctcaggaggaagagacagcagagcatggcaagct tcataggcataatctacgggctgacggcatcttttgcctttgctctagcggcatcgttccaggttgcggcttctataaac accctcttcgcccagctcaaggttccaactgaatacataggggatataatccacgttatccccccagctggaatgagctt cgtcatgtacattatgctaacgataatgataatccactccttcctctcggcaatagcaataaagaccgccgatggcggcc actggatagtcgcgctgaagtacttcgtgatcctcctgtggatattcgccgccggaatgtacgcggggcaggttctaatg gagagaatgatgggtataaacagccagacggagacaacccagctcctgagggttctaatatcttcgctc TGAGAAAGAC TTAAGGGTAAATACCCCCATATTTTCATGGTGTCGTGATGAGAGAAGGGGAACTCCGAAAACTCTGGGAGAGAACAGTCA GAAGGCTCGAACTCGAAGGCATTCTGCGCGATGAAAGGGTTAAAGAGGCCCTTCTGAAATGGCCCCGATACCTCTTCGTT GAGGAGAGGTACAGGAGATACGCTCATCTCGACGAACCACTGCCCATTCCGGGAGGACAGACTATCAGCGCACCCCATAT GGTAGTGATAATGCTTCAGCTCGCCGATTTGAAACCAGGCATGAACGTCCTTGAGATAGGTACGGGAAGCGGTTGGAACG CAGCCCTAATGGCCGAGCTCGTTAAAGGTGAGGTGTACACGATCGAGAGACTCCCCGAGCTCGTCGAGTTCGCGAGGAGA AACCTCGAAAGAGCGGGCGTCAGGGGGGTTCATGTGATCCTCGGAGACGGCAGTAAGGGTTTTCCCCCAAGGGCACCCTA CGACAGAAT