

>tg1558 Transcription regulator, TrmB-like protein (TrmB)

>tg1558 Transcription regulator, TrmB-like protein (TrmB)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1463581 - 1465594 (Additional range around tg1558 is :500nt.)

>Thermococcus gammatolerans EJ3 GGTAATGAACCAGGGAAGACTCCTCCAAGTGGGTCCCCCCACAGAGGTCTACCTCAAGCCCAACTCGCTCTTCGTGGCGA CCTTCATAGGTGCCCCTGAGATGAACATCGTGGACGCGACGGTCGTGGAGAACGATGGCCTCTTCCTTGAGGGGGACGGC TTCAAGATACTCCTTCCGGACGACTTCAGGGAGATCCTTGAGAGTTACATTGGAAAGGATGTTCTCTTTGGCGTAAGACC CGAGCATATGACTGTGAAGGGCGTTTCGACCCTTGAGCATGTAACTAGAACGGCTGAGATAGAGGGGATCGTTGATTTCA TAGAGGCCCTTGGCACGGATACGATAGTCCACGCCAAGGTTGGGGGAAACATCATCAAGATAAAGCTTCCCGGCCACATA CCCCTTCCAGTTGGAGAAAAGATTAAAATAGAGATTGACCTTGACAACATCCATGTCTTCGACAGGGACACGGAGAAAGC GATAATCTGAGGTCTGCCT atggaagaaaaggagataaaagcccggctaaaggagttcggtctcaatgagtatgaggtc agggcgtatcttacactcataaagaacggagcgctgacggcaggagagctcgcgacgctctcgaaggtgccccagccgag aatatatgacgtgataaggacactcatggccaagggattcgtcacgacgagccagagcaggcccaaacaggtaatccccc tcagccctgatagcgtcatggacgctttgaagaggcgctacaatgagcggattgacgagctcaagagcgctttggagaag ctctacactccaaaaggagagatcggaagcgtaactgtcgttaagagcaggataacattcgaagagcacgtgagaaaagc cattgagagagctcggtttcatctaagtattgccgtccccagggaattcctcaggaaaatcgaggggcccctcaccacca aaaaggaggagggagtaaggataaacctcttcgtttacggttgtgatgagatcccgccgatagccagtgaaataagggtg agggaagtccccgatcccataattatcatccaagaccgggaagagggagtttacctaccctacgaggcgctgacctcaag cagttcactgctcggctatggactcatcataagggacaacaacatactctttatgatagaccgctacttctatcatgccc tctggccgacgggaagggtagtttatcgcgaggagcgcaaactcaagctcccgcgggagtacatccacataagggagctg gtggaggacataaagaccttcaatctaacgggatcaaaggtcgagattattgggaagtttgttcgctccaagaaacctgt acacatcgtgggtagggtggtggggttttttgaggatgagaacaaagttatttccaatatcacagtagagaccgaagagg gggccaagtacgttgtcggtggctggaacgcgtcacttgaggatattgaagccgagaggatagtactccttgag TGAAC TCTCCACTGGGGGAGGGGGATGGACGCCAGAACTGCCGCACTGGAGATCATGAACGCTGCCATCGAAAGCGCGGATCCTT ACCTCGCGGTGAAAAGGAACCTCAGGGTTCAGGGTGACAACATCGTTGTGGCGGGTAAGAACTTCCCGGTTGAGGGAAAA ATATACCTCCTGGCCTTCGGCAAGGCAGCGTGCTCCATGGCGAGAGCAGTCGTTGATACCCTCGGGGAGCGTATTGAGGA AGGAGTTATCATCACGAAGTACGGCTACGCCAAAGACTGTCCCAAAATGGAAAGATTGAAGGTCATCGAGGCCGGACACC CCATTCCAGACGAGAACTCTCTCCTAGGCGGAAAGCTCGGCCTCGAACTGGCCGGGAAGGTTGGGGAGAACGACATCCTC CTCGTCCTCATCTCCGGCGGCGGAAGTGCGCTCTTCCTCCTTCCCGAGAGGGGAATAAGCCTGGAGGACAAAATCCAAAC GAACGAACTCCTTCT