

>tg1566 Fructokinase (scrK)

>tg1566 Fructokinase (scrK)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1472098 - 1474045 (Additional range around tg1566 is :500nt.)

>Thermococcus gammatolerans EJ3 CTCGTTCACCGCGCTCTCCCAGAGCGAGGCCCCGACAGATGTGATGCACGTGGTTCCTGCCCATGCCGGATCGTCGTCGG CGTAGAGGAGTATGGGCCTCTTGGTTTCCCTGACGAGTGCCGTAACGAGGTTGCTCTCCGTCCAGTGCCAGAGGCCGGCT ATTATTCCCGAGACGGAGCTTCCGGCTATGATTTCTCCTGCCTTAAAGCTCTCATCCATCGAATCTACCCCGAAGTTCTT ACCGGCGTTGAGGGCCTCGTATTTTCCAAGCCTCTCGTTCACGTCGAGAACTTCAAAGCCGGCCTTCCTCAGCTCCCCGA TGAGGGCGGAGTGCTTCTCCATCAAAGCCCTCTCGCGCTCGATCGAGAGGGCCGTTGGTCGGGGGTCGGTAAAGGTAATG ACGGCTATCATAGGCAGCACCTTGGTATTTCAATCGCGGAAAACGTATATAACGATTGTCAGAGAAAACAACCAAAAGTT GTTGTTTGTGGTGATAATG atgattgtctctattggagaagtcctcatagatttcatagccctgcaggaggggaagctt aaggatgtgaagtccttcgagaagcatcccggcggtgctcccgcaaacgttgctgttggcctttcaaggctcggcgttga gggtgcgctggtaagcaaggttggcgaggacccctttggggactttctactcgaaagactccatgatgagggtgtaaaga cctacgtatcccgggacgctgaaaagcacaccggcgtcgtcttcgttcagctcatcggtgccaaaccggagttcatcctt tatgacggcgtcgcctatttcaacctgaagccctgggatgttgaaacgacccctcttgagaacgctgaagcggttcactt cggcaccgtgctcttcgccagggagccatcccgctcgactctcttcgggattttagaggaacttaagggaagggttccgc tgagctacgacgtcaacataaggcccgatctctggcgcggaagggaggaggaaatgcttcggaatattgagagggccctt caactggcggatatagttaagctcggtgatggggagctggagtacctcaggaacaacggaataagcctcgatgagttcga tttcaaactcctcgcggtgacctcgggtgagaagggtagtgagctgacgagcggagacgctaaggttcacattccggctt atagagttgagccggttgacaccacgggagcgggagatgccttcacggctgcccttctggccggccttcactactcaaac ctgctcggtgaggattccatagatgaggagcacctcagaaaaatcggccgcttcgcaaacctcgtggcggcgatctccac cacccggcgaggtgcctggagcgttccaaaaatggaggaaatagttcagatgaaggaagttagggagctctaccagcgct ccaggagg TAGTCCTTCTCCTCAAGGAAGACCTTCGCCCTCTCCTCTATCAGTTTTTCGGCCTCAAGGGTGCTCATATT AATCGTTCTCTTGACAAAATCAGCAGTCTTTGCGAAGTACAGGGGCACGAGGGGTTCAGCCTCGGTCAGGATTCTGTTTT TGTACGCCACTGCCCCGTCGTAGAGGACGTGGCTCCAGAGCCTGTCGTCGAACTCGAAGGTCTTGAGGGCTTCCACAACT CCCTTGAACGTCTCTTTGTCCAGTGCCCTCCTCAGCACAGGTTCGTGCTGGGCGAATAGCTCCTTCGCCCTTATCTCCAG GAGCTCTAAGGTCACCTTTACAGGCTCGGGTTCACCTTTCTCAAGCTCCCCGAAGACCGGAACGGGTTCTATCGTTCTCA CGTCCTTCCAGACGTCCTCGTACTTCTCCATAAGCATGAACAGCGTTCCGACGACCTGGTTGAACATGGGGCCGAGGGAA GCGGCTGGATCCTTGGGGTCGTGTATCTT