

>tg1568 Amylo-alpha-1,6-glucosidase, putative archaeal type glycogen debranching enzyme (gde)

>tg1568 Amylo-alpha-1,6-glucosidase, putative archaeal type glycogen debranching enzyme (gde)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1474616 - 1477475 (Additional range around tg1568 is :500nt.)

>Thermococcus gammatolerans EJ3 GCGGAAAGCCGCCGCTCTTTGGAGACATAAAGTACGTGGACGATGAGGTCGTTATGATAGCCAACTGCGGCGCTTCATCG CTCTACTACGCGAGGCTGAGCGAGAACCCGGAGGAGAACCTCAAAGCTACTATAATCCAGGGACAGTGCCAGGGGGCGAG CGGCGGGGCGCTAACTTACAGAACTCCCCCGGCGGAGTTCACCGTGGCGAGGCTCATACGTCGTGGAGGTGAATACTACC TCCTCTACTTCTTCGCGGAGGGCCTTGAGATAACGGAGGAGATGGAGTCGAAGCTCAAATGGGGCAAGCAGTGGCCGCAT ACGGCCATAAAGAACCCGCTCGACAAAGAAACCTTCATCTCGGCCATGGGAGCCAACCACCTCTCACTGGTTCCCGGCGA CTACACCGAGGAGCTCCGCTTTACCGCGAGGCTCTGGGGAGTAAAGGCAATAAACCTTGAAGACCCAAGGGAGGTAAAGT CCTTCCTTGAGGGGTAGTCC atgagaaccatcttagccggcaacggagccttcgtcctgagcgatgagaggggggacat gccctcccattacgacggcttttattttcttgacacaaggttcgtcagaaaggccaggcttgaagtttctccggaaccgg acttcatcggggcatcctcaaccttcacccgggcggtttcacacttctctctcggcgagcggggaatcctggtgaggcta agaacgctggacggggtttacgaggaaaagctctccttctacaacacgtcggaagaatcgctcggtgtcaaggtcaggta ctcctacgaggcccccattgaggacatattccaggtcaggggcttcatggggctgaagagcggaaaggcgatagccccag ccggaggaacgcacgtcaaagagagcccctccggaaggaggagtctctccatcgagaccaacatggaaagggaggggagt ctcttaagggcggaacttgagatacctcccctcggaaaggcagtcctctacgtccgcttcatccccaaaatcgaggggag tatctcggagatactcggggagaaaaggaaaacgataaaaaacgtcgccttcaccggctcacccgccatcgacgggatat ttgagagggcggttgagaacataaacgccctgacgctattcacgcgcttcgggcctgttccccttgcggggattccgtac ttcgcctgtcccttcggaagggacgcgataatagcctcactctttctcctgccgtattaccccgaatacgccgccggcac gctgaggctcttcgggcggctccaggggaagagaaccaacccgaagaacgaggaagaacctggaaagataccacatgagt tccgtctcggggagctcgcgcagtcggggaaggttcccttcgcgccctactacggcacggtggatgccactccactctac gtggcattagccggtgagtacctgcgctggacgggggacagaaaattaatcgaggaactgagaccgaacctgacggccgc cgtcgagtggatactcaaaaagctcgatgatgggtacataacctacgttccggggatactcggcaacaaggggtggaagg attcgagggatgggataattgacgaggaagggaaaattccaaagccgccgatagcgctcgttgaggtgcagggctacacc tactgggcgcttaaacttgcaggggagctcagcctgacagacctcgatgaaaaaacccttctcgcagaggcggaaaagtt gaagaaaaggttcaaccgcgacttctggctcggctcctactacgccctcgcgcttgatggggagggaaggccgcttagag tcgtctcctccaacatgggacacctactcctgacgggtatagccgagcacgaggaggaactcgcggagaggcttttccgg ccggacatgttctcccggtacgggataagaaccctgagcgctaaggagaaagcctacaaccccttcagctaccaccgcgg aagcgtatggccgcacgacaacgcgctgatagccctcggcctggcgaggattggaaggactgacatggcgaaggcactca tggatgccgtcttcgatgccgcgaagcttctgccggagagggagcttccggagctgtacagcggcctaaacgagctcgtt cccgttccaagggccaactccccgcaggcctggagctcggcgagcgttttcgccttcgttaccgcctcgctcggaatgga agccggggatgaactcaccgtccggccggccgaggggacgagcatcgttctgagaggggtttcttttggagggaggagat acgtcgtagtggtcaacggaggtgttagcgttgaaccccta TGAGTTCAGGTTTGAAAAACTCCCAAAACCCGTGCTTT TCCCCTCAGATGAAGGATTCGACTCAAAGAACGTCTACAACCCTGCGGTGGTCAAGAGGAGGGGAAAGGTGGTTATGCTC TACCGTGCGGAGGCCAAAGGGGAAAGGATAACCGGAAGAATCGGGCTGGCGCTGAGCGAAGACGGGATCAACTTCATCAG ACACCCTGAACCAGTTATGGAGCCTGAATACGAGTGGGAGAAGCTCGGCGTTGAGGACCCCCGCGTCGTGAGGATTGAAA AGACCTACTACATGACCTACACCGGCTACGATGGAGAAACCGCCCGACTCTGTATCGCCACCTCGAAGAACCTGCTGAAC TGGAAGAAGCACGGAGTGGTTTTCGAGGAGTTCCCTTTCCCCAAGAATGGAAGGTTCAACTGGACAAAGAGCGGAGCCAT ACTGGCCGAGAAGATGAAATTTGGGCCGTTCAAGGGGCACTACATCATGTACTTCGGCGAC