

>tg1570 Permease, major facilitator superfamily

>tg1570 Permease, major facilitator superfamily

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1477446 - 1479711 (Additional range around tg1570 is :500nt.)

>Thermococcus gammatolerans EJ3 AGGGGCACTACATCATGTACTTCGGCGACTCCAACGTCTGGCTCGCCTATTCGAAGGATCTCCTCCACTGGGAGTACGAG AGAGAGCCCGTTTTGAGGCCGAGGGGTCATCTCGTCGAGCCCGGGCCTCCTCCAATCCTCACGGAGGATGGAATACTCCT GATACACAGCGAGGCCTTCCATGAGGAGGGAAAGCTCGTTTACTACACTCACGCGGCTCTCTTCGACTTGGAGGACCCGA GAAAGCTCATCTGGAGAACCGAGAAGCCCATCCTCAGGCCGACCTTCGACTGGGAGCTGCACGGGTGGGTCGACAACGTG GTCTTCGCCGAGGCCATGATAGAGCATGAGGGGAGATACTACCTCTACTACGGCGGTGCCGACAGGTACGTTGGCCTCGC GATAGGAAAAATTGAGACCTGAGTCGAGCGTCGCTAAAGTCTCAACGCTTGCGACGCGTGAAGGTTAAATTTTTAAACCC TCTCTTTTTCTCCCGCGCCT atggcggtcagtcagaagcgcaagagaacgaccctcaagaagctcgagagaaaaagcca gatgaggcaccggccgaatccagagaagtggttttactccttcattcccttcaaggtctcaaccgggggagttgctccct tgatcccactcctcactatggagctcggtggcggtccgcgggaagtcggtattgtaaacgccgtcgggagctttgcatca atgctcggcggccttttctggggaaaactcagtgaccggctcaacaggcggaaggttttcctcgtaaccggctttcttgg aacggcactctcaacctttctgttcgccctagcgagaagtgtttcctcagtgatttttgcaaacgccctctacactttct tcatagccgcaacggttccgattccagtcctcataatcaccaaggcgttccgccttgaggactgggactacgagataggg aggttcaacgagatatgtggctgggcctgggtactggggcttgtggttgggttcgtcctgtcccacctgcttcccctccg gtggatttttgcagttctcggcttaatcggccttctctctgccccctggggtatgaggacgataaaggaagtcccgcttc acctcagcagaaagatcctcggcgtctacgcgggctacgtcgtcgaaaagttccgctacctgccgaacttcattacccac ctgccaaggctttccacgaacggattcggcgggctttacctctcaactttcctcttctggttcggggcgatgctgtactt cacccagttccccgtcctcctgaaggtgagaggctttggagcctcgatgctctatttgatgagcatcggaaactcagcgg tctccgcctatatgtacgcccgcgttggaaagagggttaaggcgaagggcggttacagaaccctcaagctcggcctcctc ctgaggggcctctctttcctcctgctcacctttgcgacgttcataaccggacccctctttcccgttctcgcgttcatctc ctacttcctcgctggctatacgtgggccttcataggcatctcaacaaccaccgtaatttcccgtttcgctccaccaggaa agaagggaaccctaattggagcctacaatctcgtgagctccctgggagcagtagctggaaacctgacgagcgggttcata gtctcacttctgggtcttacaggcaactttgcgctcgcctctgcgttcatcttcctctcgctccttccgatagctcgtct caggggt TAAAGTTCGATAGTGCTCCCTGTCTTCACGCTTACGAACTTCTCAGGGTATTCCCGCCGCACGTAGGCCTTG GCTTTTTCACCAGAGCAGTGTGCGGGCGCTATAAATTCAGACATCTTGGCAAGCCTGTCTAGAACCGCCCTAGATGGGTA ATGGAAGCCGCCGATTACAAGGTGGGCTCTTTTGTACCCTGAAACCTCAAGGACGGCCTCCGTCAGCCTGTCTGGGCCCG GATGAGAACAGCCGACTATGACGACGAGTCCAGAGGGCGTTTCCACCCCCACCGCCTGCTCGAAGCCATCCAACGCTCCA GAGGTCCAGACACCATCGGCTATTCTCCCCGCTTCGTGCATTTCGGCGATGTTTAGTCCCCGGATGTTCCCTCCAGGCGG AGCGTACAGTTCAAGCCCCGGGTTCAGCTCCGCAATTGTTGAAAAACCGCCGTAGTGGTCGTAGTGCCAGTGGCTGAGAA CCGCGAAGTCGAGGCCCTTCAAAGAAA