

>tg1575 Prokaryotic ATPase, AAA superfamily

>tg1575 Prokaryotic ATPase, AAA superfamily

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1485270 - 1487619 (Additional range around tg1575 is :500nt.)

>Thermococcus gammatolerans EJ3 GGAAGGAAGAGAGAATCTACAGAAAGATTCTCAAGGCGGCCGATTTGGTCGATACCTACGGCTTCGAAGCGGTTCTAGCG CTGGCGAGCTACGGAACGGGACCAGATACCGCCGCGCGACTGCTCGCGCAGTACCGGGGAGACGCCTTAATCCTCGCGCT TATGGAGAGGGAGAAGCAGTTCATAAGAACGAGGCGGTTCTGGGTTGAGAGGAAGGAGAAGGAAGATACAGAAAACGGGA GTGCATCTTGATTTTGCGTTCTTGTAGAGACAACAATGCTTAAATATGTCGGTACCCCTCCATGACAGTATGGTAGGTGC CTATGCTGTTTGGCAGAATCAAGAAATCGCGGCATGAGATATTTGACAGGGAGTATGAATTCAACCACTAACAAGGGTTG CTGAGGATGGAGTTCCCCTAATTGTTCTCATGGGAATCAGACGGAAGAAGAGAAAAGGCTTTCGAAACCGTTAAATAGTT GCAGTGCGATTAGTCTAATC atgatgcaacaattcgtcaacagaaagggcgagctcgatgctctcaggagggcctttga gggcgacaaagcggagctgatagtggtttacgggaggagaagggtcggaaagacggcgctcgtcctgaaggccgccgaag ggttcaggcacgtctacttcctcgcggacgagaggagcgaagcggagaacctcgcggagttcaggaagaaggtggcacaa ttcctgggcgatgaggtcgtcgcccgctccgacctcggctggatcgaggtgttccgtctcatcgcggagcgtggaaatgg agttgtcatgatagacgagctcccctacctcgttgaaggaaacccggctttcccctcggttctccagaaggcatgggact tgcatctccagaactcgaaggtcaagctcgttctcgtcggctcgtcaatcggcatgatggagaggcttctcggccataaa agcccgctctacggcagaagaacaatgcagattgacctcaagcccctcaggtactggcacgttcctgagttcctgcccgg ctactcccccgaggactggatgagggtttacggcgttgccgacgggatacccctctacctgaagcagttcgacggtagtt catcgttctgggagaacgttggaaggctattcctcagaaaggagagccccctctacaccgaggcggagttccttctcaga caggagttcagggagccggcgcggtacttctcgatactgaaggcgatagccttcgggaagacgagcttcggggagatagt gaacttcacggcctttgacagggggaccgtttcgcgctacctcgacaacctcgccagaataagggtgatagccaaggttc acccggcctttgagcccgagaagaggaggaacacccgctacgagttcgccgataactacttccgcttctggttccgcttc gtctatccgaacagggagaggattgagcgggagctctacactgaggttctgaaggacgttaaggcaaacttcgaccacta catgggacctgtgtttgagagggccgctgaggatttcctgtggcggaggttcgccttcgagcggggcggaaggtggtggc gcaggggagaagaggtcgacttcgtgggcgtgaagaacggaaccgcgtacttcttcgaggccaaatggggcaccttagac catcgagaggccctccgggttcttaaaaggcttgaggaaaaggccgagaacgtcagaaccggggcaaagaaaaggtgcct cggcatcgttgcaagggccgtagaggacagggaaaggcttgaggagaggggcttcctcgtcttcgagctcagggacctct ttggattctct TGAGGAACTCCTCTGCCCTCTCAAGCTCCCCCTCTCAAGCAGGAGCGGAAGCGTCGAGTAGAGCGCCA AGGGTCGCTTTTCGGCTTTTCCAAGAGCTCCTCAACCTTTGTCTTCAGCTGGAGATAAGCCTTTCCCCTTTTGAGGAAGT CCCGCAGATCCCAGACGAGGTAGCCCTCCTCCCTCAGCTCTTCCTTTCCCTCAACGCCCCTTGCGATGAGGCCGAACCTG AAAGCGCCGTCAAAGCGGACGAACCTTGCTTTGCCCTCCAGCTCCCTTAAAATCCTCCTCGCCTCCCTCTTGCCCAAGTC CTTCCACTTGACCTCAATCAGGCTGGCCATCCCCCTGCCCAACGCCACGATATCGATTTCTTCGCCCCTGAACCACCACC TGCCGAGGGTTTCGAACTCAATCGGCCTTTTGAGAAGAATGAACTCCCTCGCGAGGTCCTCAAAGCGAACCGAGAAAACC CTGTAGAGGTCGTCGAGCTTAGCGGTTCCCG