

>tg1577 Acetyl ornithine deacetylase related protein (argE)

>tg1577 Acetyl ornithine deacetylase related protein (argE)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1487311 - 1489372 (Additional range around tg1577 is :500nt.)

>Thermococcus gammatolerans EJ3 GGACAGTAAACACGGCCCTTGAAAAATGGCTGACGGGGGTTGAGGAGTGCAAGAAAGCCCTGGAAAGGGTGGGAATAGAA ACAGAGGTAACTCCCGCTGAGCTGTGGGATTATCTGAACGCGAGAACATATGAAAACGATGTTTATGAGCCCGGGGAGAT ACTCTCCAACGACTACCTCGTGATTCACGAGGTCAGGGAAATTGAATGCCTCAAAGCCAGAGGCCTTGAGATAACGCCGA ACGTGATAATCGAGAACCCAAAAGAGACGTACGAGTGCCACCTCATAGCTCTTGAGGCGGAACTCCAGCGTGCTGGAAAA GAGGGTAATGCTAAATGGATTAAAAAACGCTGCCGTGATGTTGAAGAGTACCTCCGAGACGAGAACTTGCCTGAGAATCT GAAGGGACGAGTTGTAGCAATACTTGAGAGGTTCTGCACTGTATCCTGAGACGCTTGGAATGCCGAGGTTTATAAAGGGC GACGTCGAGGGTAAGTTAG gtgaaccaaatgaagaccgagagagcgaaggaaatactcctccagcttttgaagataccc tcgccttcgggccaggaagacaggataatgctccacatcatggagttcctccataagctcgactacgacgtccacatcga gagcgacggcgagataatagacctcgtcgtgaaccctgaggcggagctcttctacgaggtccacgtggacacgataccga ttcgcgctgagcccttcgtcaggggcaacataatctacggcaccggcgcgagcgacataaagggcggcgccgcggcaata ctcctcatgcttgagagcctgaagagggaaaacaaggacctcaacgtcggtatcgtcttcgtcagcgacgaggagctcgg cggtcgcgggagcgcgctctttatggagcgttaccggcccaagatggccgtcgttctggaaccgaccgaccttgaggtgc acatcgcccacgccggcaacatcgaggcctactttgaggtggatggcaaggaagctcacggtgcctgtcccgagagcggt gtcaacgcgattgaggagacctataagatgctcgaggagcttaaaaagctcgaacccttcaataccaagggcgagttctt cgacccacacattggaattcaggagctcgtctgcgagaaccccgtttacctcatccccgccctctgcaagggaaggctcg aggcgagactcttaccagagcaggaggtcgaggatgtcctcgacttaatggaccctatactcgacgagtacaccaagagc tacgagtacaccgagatatgggacggctacaagctcgaaccggacgaagagatagtccagctagccaagaaggcgatgga gaagacgggcctcgacgagttcggcggaatgaggagctggacggacgcgataaacttcatgtacaacggaacgaggacga tagttttcggcccaggcaacctcgacatctcgcacactaagttcgagcgcatagacgtcagggacgttgttacggcaagc gagttcctgaaggccctcaatgagatttacgggaagggcgac TGAGCATTTCTTTTTCCCTTTTGACCCAATCTTTTTA AGCAGGCTCCCACCAGTAACTGGTAGAAGAGTTCATAGACCGCGAGAAAGAGATCCCAATCCTCGGTAGCAGGAAGGTGA GCCTTTACAGGATAAGCGACCCGATTCTGCTGAGCTGGTTTCTCCTTACCTACCCCCAGATGGCCGAGATAGCCTCGGGA ACCGCTAAGCTCGACGACCTCTACAGGGTTTTCTCGGTTCGCTTTGAGGACCTCGCGAGGGAGTTCATTCTTCTCAAAAG GCCGATTGAGTTCGAAACCCTCGGCAGGTGGTGGTTCAGGGGCGAAGAAATCGATATCGTGGCGTTGGGCAGGGGGATGG CCAGCCTGATTGAGGTCAAGTGGAAGGACTTGGGCAAGAGGGAGGCGAGGAGGATTTTAAGGGAGCTGGAGGGCAAAGCA AGGTTCGTCCGCTTTGACGGCGCTTTCAGGTTCGGCCTCATCGCAAGGGGCGTTGAGGGAAAG