

>tg1582 Permease, major facilitator superfamily

>tg1582 Permease, major facilitator superfamily

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1491811 - 1493971 (Additional range around tg1582 is :500nt.)

>Thermococcus gammatolerans EJ3 ATTCCGATTATTTCGAGCCACTTTTTGACCACCCTCTTTGAGAGGGCGTAGCATTTTCCCCGCTCGCCGGGAATCTCAAC GACGATGCCCATCTCCTTCAGCTCGGCCAGCTTCGCTCGAACCGTGTTGCGGGAAGCCTTTCCGCGCCTACCCTTCAGCT CCCGCGCTATCTGGCTCACGTTGGCCCGCTTGAGGTCGAAGAGAATCCGGACGATTTCCCTCGATATGGGATCGGTGACT TCGGGAACGGCTACCTCTATTCCCAGGCTACCGTACTGGGCGTATAGATTGATGAGCCGAAGGTAAGCCTGCGCCAGCTG GGAAACGAGGGCGAAGCTCTCCCTGAGCTCTTCGAGCGCCTTCCTGAGCTCCTGCACTTCCCTTGCGAGCTCCTCGTCGG GCATGGTTAATGGTTGGGTGATCAACCCTTTAGCGTTTCCGGTCAGGAGTGAGCAATTAACTGGGCAAAACTTAAGGCAA GAACCCTCAAAGTCCTGCC atgaagcgaaccctctaccgcctgcacgtcataacctcatccctcagaatcgttggggac gccatcgagtacgtggccttaccctggagcctgctgaacgcgacgggctcgctgatcagcataggcggtttttcgctctt cacccatctgccgtgggttctcttccccccaattcttggcagggccctcgatagagctaccaaaaaggtgaggcttgcct tcctcgctctcatcctccaggccctactggcggttcttatagtgccgctctcctcgaacgtctgggctttctacctcata gtctctggaatatccgctctggacattctccaccgctactacgggctctcgctgattgcctcgatgacccttgactcttc agagctccaaagcctcaacgcaaagctcgccacggttgaaaacgccctatccctggtggcttttccactggccggcttct tgacctatcgcttcgggataagggcaatgctcctcgacgcggttctccttctcctcggagcgctcgcgctggttccctac ctgaacgttgaggtgaagcgcgaagggacagaggaggcaagggaagagaaacggctacaaatcagccgtcggctcgtggt tggagtactcgcctcggtgctgctcttcaacttcgctctcggttccttcaggatattcgtcttcgcctccttaaaggaac tcgcaaaaggtgaggtcctctacggcctcctccagggactcacgacggtcggaagcctcgtggcggtcgcggggctgaca tacctggcccggaagaggctggccggactaaagcggccgctgatcctcggaatgctcctccagagcatcgcgctcctcat cgtcggcgttccggcggtggtagcgctgttcccggcggttttcatcctcggcttcggcggggagctcctcaacgtctcgt tcgacagtctgatgcagaggttcatcccccttgagagcctcgggactgcgaggggcgtttttgacgcccttgcgacgatt gtgattccgctctcgcatctggtttttgcgtggctgattgaaaggggtgtagagacgttatgcctaacttcagcggcgtt tcttatcggggctctcgcagttgggctcttcgccatcactacgagaggccttccgtcaggt TGAGCAGCCGCTCCGTCT GAGCGTTGGTAAAGTTGCCCCTCCTCGATTTGTATATCTCGCTTATTGATTCTCCAATTTCCTCGAAGAGATCTGCGTTT CTTTCAAGGTCATCTTTTGCATAAGGATAATGAACGTTCACGTGGTTTAGGAAGACCTCTAGGTTGGACGCGGCACTGTG GAGGTTCCAGTACTTCTCGTCCTTTGTCAATTGGTAGAGGTCTCCTGCAATGTCCGCGAGTACCCAAGCGCAGTAGTTGA ACCTTCTTACTTTTTCATAGAGTACCTGGCTCTGGAGTGGGTCTCTGGTTGCGTTGTGTTCGATCATTGATTTGAGAAGG GTTATCTCCTCAAGGCAATGGAGGGTTGGGGTTAAAGCGGAAATAAGGCCGTTTTTGGCCTTTTCTGACTCAACACTCTT CTGGTGGTATGCGTAGCCAAGGGAGCCCGAAACGATTAAGAGCAGGACAAGTATCAGAGATGTGACATGTTTCATTAACA CC