

>tg1587 Zinc-dependent metallopeptidase, putative

>tg1587 Zinc-dependent metallopeptidase, putative

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1495393 - 1497553 (Additional range around tg1587 is :500nt.)

>Thermococcus gammatolerans EJ3 TCCCTGGCGATTCTTCTCAGGGAAGACCTCCCCAAAAGCTGGGAATGGTTCAATGACAGGAGCACCGTTAGGGGTCTCTT CAACTCAGCCCACTTCACCCTGCCCGAGGAAGAGGAGGAGTTCTACGAGGAGCTGAAGAGGAACAGGGAGAAAAGTCCAA CTTTCGCGGTGATAGAAAACGAGAGCGGAAAGCTCGTGGGCATAGCCGGATTCAACTGGATCAACTGGCAGGCAAGGTGG GGGGAGATACTCTACTACCTTTCACCGGAAGATAGGGGAAAGGGTTACGGGACGGAGACGGTGAAGCTCCTCTGCGAATA CGCCTTTACTCATCTCAATCTCCACAAGGTCTGGGCGAAGGTTCACAGCGACAACATTCCCTCAATCCGCATTCTCGAGA AGAACGGCTTCTCTTTGAGCGGACGGTTCAGGGAGCATGTCTGGAGCGACGGGAGGTACTTAGACGAGCTGATCTACGAG AAGTTCAGAGGGGAAGAAA atgattgaacgtctggaactccgcctgggcctcaactttgagagagggacgctggaaggg atggcaaagttaaaactggccggaaaagcggggaccttcctcctcaatcggggtttgtccgtaaactccgcgagcgctcc cttttcccagcgcgttgaagggtttaatggacttgaggcctacgaggccagcgtcgttcggcttgagctgccacttgaag aagttgagctgacgtactccggcaggcttgagagctatgaaagcgttctcccgtacctcaaggactcaataaatccggag tataccctcctcaggactgactcgctcttctacccgattccctcagagccggacttcgagagcctcatcaagtctgtcgt gggctcggagtttgacgccgagataaccgttgaaggcattcctgaggggttggtggtcgcgttcggcggggaaatcaagg aaaaccggctgagaatcgagggcacaaaaaggctcgacatcgcggtggcaccgttcaaggtcattgaaaaggagcccttc aggctcttcattcttagcgaggaaggaattgagaggacacttgacctactcgggaaagcgcacgaattctactcaacaat tctggggagcagggtggagaagtttaccgtcatcgagacgcctgagaactacggtgggcaggccgggaagggctacgcgc tagtctctggaagctcgctcagggcggagataccagcaaacctctaccacgagctcgcccatctctggaacccgagggca acgcccgaggcgcaccagagcaggttctttgacgaggccttcgccaactacctgactgcgctggcgattagggagataca cggcgaggaagccttcaaccgcttcatcgaaggcctgagaaggaattacaaggcagtggttaagcgctttccagaggcag agaagctcaaaccgtcggagtggggagagttaggcctgtgggagctatcgtacacgaaaggggccttaatcctttacgac cttcacctgctaatggaggattccttctacgatctgctgagaattctcgcgggagctgagaacgtggattttgagagatt caaaaaactcgcggaggagttgagcggaagagacctgggagacttctttgagaggtacttt TAGCCCCCGCAGAAACAG AGCAACTCCTCTGGCACGTTCGAAGAGGAAATGCAACCGCCACCAGTCTGGCTACCTCCGAGTTTTCACATGCGCTGCAA AAACTATTTATACTTTCTTCGAGTAGTAAAGCAGGGGTCACCATGAAGAAAGTTTTAACCCTTATCCTGGTTGCCATCGT GATCGCCGCCGGATGCCTGAGCTCCCCTGAGAAGTCCCCTGAAACGAAAACCTCAACCCCAACGGCCTCCACAAAAGAAG GGTTTTTGGCTGAAATTGGAATAATAGCCCCATCGGATCCCCTCTGCGGGATGGACCCAAACAGCAGCATCGCCGGATTC ATCAAGCCCCTTAAAGAAAAGTACTCGATCGTACCAGCCAGGCCAGATTTCCCCGTTCCGGAGGGCAGTCTTGCAAATAA AACCTTTAAGGTTTCCAACGCGTACATCGGCGTTTTTGCTTATCCGGATTCCTATTCGGCAGCAGAAGCGTTGGGCGCGC TC