

>tg1593 3-phosphoshikimate 1-carboxyvinyltransferase (aroA)

>tg1593 3-phosphoshikimate 1-carboxyvinyltransferase (aroA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1500343 - 1502536 (Additional range around tg1593 is :500nt.)

>Thermococcus gammatolerans EJ3 ATTGAAATAGCTCCCCTCGAAGCCATAAAGCTCGGTGTAGAGGCCGCAAGGCTCGCGGGAGTGACCATCACGGGAGCCTT CGACGACGCTTCAGCCTCCCTCCTCGGTGGCCTCTGCCTGACGGACAACACGAGGGACGAGCTACTCAAGCGGGAGGAGG TTGAACCCGAGCCCGTTGTCCTCCTAATACCAGAGGAGAGCATAATGACGTCGAGCCTCAAGGGCATGGACTTTTCAGGC ATAGCGCCCTACATAACGGAGGCCTTTGATATGGCCATGCGCGGGGAGTGGAGGAAGGCCCTCGTGATAAACGGCCTCGT GTATTCGGCATTCTTGGGGCACCCAACCGAGCCAATCGGAACGGCCCTCAGGCTGGGGGCCATCGCGGGGCTCAGCGGGA AAGGGCCGGCTTTTTTCGCCCTGACCCGGGAGCCGGAGGTTCTCTCCGAAGAGTGGAGTAGGTTTGGAAAAACGGAAATA ACGAAGCTGAGGTGATAGC ttgattgtagagccagttgactggcttgaagggaaggttagggctcctccctcgaagagc tacacccaccgggcgttcttcctcgcgctcctcgcggatggtgagagcacgatcgaggaacccctcgtgagcgacgacac cgaggcgacgctgaacgccataagggccttcggggctgaagccgactggaaccgcgttgttccgccggaggagctcagga aagcggagataaacgcgagggaatcgggaacgactgcaagaataagcgttgcggttgcctcgctcgcgaggggtaggagc gttatagatggccaaggaaggctgagggagaggcccttcgccccgctcgtccgcgcgctccgctctctgggggtaacggt caggggggagaaactcccgattgaggttttcggcggaatgcccggtgggagggttagcgttgacgcctcgctctcatccc agttcgtcacggcccttctgatactcgcctccaaagtggggatgcgcgtcgagttcgagaaagccgtgtcaaagccctat atagagatgacgctcaggactatggaggcctttggcgtaacctttgagcggaacggaggagttagagttttcccgggagt taagggaacaaaattccacgttcccggcgactactcgagcgcctccttcttcttagttgccggtgcgctgtacggaaggg tgagggtcgagaacctcgaccccggagacgttcaggccgatatggccattgtcgaaattctgggggagataggggccaac gttaaggtcgggggggactacgtggaggtttccaggggagagctgaggggcttcgaaataaactgctcggactttccaga cctgtttccgatactcagcgtattggcggcgtacgccgaggggaggagcgtcatcaggggcagacagctgaggtataagg aaagcgacagggttcgcgcgatggcagtcaacctcgccagagctggtataaaggtgagggaactcgaggacggcctcgaa atccacggcggaaggccgaggggggttgttgtcgaggacttcaacgaccacagggttgcgatggcgatggccgtgctggg cctcggggcgagggggaagacggtgattaaaaacgagagggtcgttgccaagtcctatccggggttttttggcgatttga ggaggttgctcgga TGAAGGGGAAACTGCTGAGCTTCACGCTCTTCGGGGAGAGCCACGGGAAGGCCGTTGGAATCCTC ATAGAGGGCCTGCCGCCGGGAATAGAGGTGAAGGTTGAGGAGATGAAGGCCGAGCTCGAGAGGAGGAAGGGCATTCGGCG GTTTTCGACGAAGAGAAGAGAAAGCGACGAGCCCGTTATCGTCTCGGGGGTCTTCAACGGCTTCACCACTGGGACTCCTG TTACGGTTCTCGTGTGGAACAGAGATGCCGATTCCTCCTACTACGAGGAGATAAGGAACACGCCGAGGCCCGGCCATGCG GATTATCCAGCAAAGGTGAAGTTCTTCGGCTACAACGACTACCGCGGCGGCGGCCACTTCTCGGGCAGGCTGACCGTCGG CGTCGTCATAGCGGGCTACTTCGCCAAAAAGCTTCTCGAGAGGTTCGGCATCAGGGTTAGGGCCTACATCAGGAGGATAG GCCCGGTAGAGTGTCCCCAAGTTGAGCCCGAGGAG