

>tg1614 Histidinol-phosphate aminotransferase (hisC)

>tg1614 Histidinol-phosphate aminotransferase (hisC)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1517235 - 1519254 (Additional range around tg1614 is :500nt.)

>Thermococcus gammatolerans EJ3 AGAACCCTCGAGACCGGCTACGCCCACTACTACTCCCGCTTGCAGGGCAGGGTGAGAATGAAGGGAGAGGTCAGCGGGAA CACGCAGAGGGTCAAGGAGATAAGAATCGACTGCGACAACGACGCGCTCCTCTTGATAGTCGAGCAGAAAGGAGTTGCGT GTCACACGGGCAACTACTCCTGCTTCTACCGGAAGCTGGGCGAGCCGGAGAGGGTCCTGCCTATGGACTACTCGCTGACA ATCCTTAGGGAGCTGGAGGAGCTGATAAGGGAGCGGAAGAAGAAGCCCGTCGAGGGCTCCTACACCTCGAAGCTCTTCAA GGCCGGTAAAGAGAGAATTTACAAGAAGTTCGGCGAAGAGGCCGTTGAGGTTCTCGTCGCAGAAACCAGGGAAGGTCTCA TCTACGAAACCGCCGACATGCTCTACCACCTGCTCGTTCTCCTGGCTTACAACGACGTTTCCCTCGGCGAGGTGATGGCC GAGCTGAGGAGGCGGAGGAA atgataagcgagctggttaagtccttccagccctaccgcgtcgtcgaggggaactatcg aataaggctcgacaagaacgagaacccctacgacctgccaggagaggtaaaggaggaaatcttcgaggagctgagggagg taagcttcaaccgctacccccacataacctccatgccagcgagggaggcgatagctgatttctacggcgtctcaccggac aacgttgcagttggcaacggaagcgacgagctgttaagctacctcgtgaggctcttcgagggcaaccacatcgtgattac cccgccgaccttcgggatgtactccttctacgcgaagctgaacggcgttccggttgtggaagtgcccctgagggaggact tcacgctcgacggagaggccgtagcggagaaggccaaaaacgcaagggttgtcttcatagcgtcccccaacaaccccacc gggaacctccagccggaggaagagataatcagagttctcgaaaccagaaggccagttgttctcgacgaggcctacgcgga attcgtgggaaaaagcctctggaggctcatagaagagtatccaaacctagtagtgctgaggacgttctccaaggcctttg ggatggccggaatcagggccggctacatgctggcgggcgaggaaatcgtcgacgccctctaccggataaaatcccccttc agcgtcggaatcatgacgatgacggccataagggtcgccctgaggcacgccgaccttatggagaaaaccgttaggaaaat cgttgaagagcgcgagaggatgaggagaaagctcggggagttagcctatccaagcgacgccaacttcctcctcgtcaggc tcaatgcctacgaagagcttttgaagaggggcatagttgttagaaagctctccggaaggcttgagggccacataagggta accgtcggcaggagatgggagaacgatgcctttcttgaggcggtggaggagatagcaggtggtgaaagtgtgggtggtct t TGACATCGACGGGACGCTGATAGACGTGGGCGAGAGCTACGACTTGGCGGTTAAACTGACGGTGGAGTACTTCCTCAG GTCTTTCGGTAGGGAGCGGGAGGTTGAGCTCGAGTGGATACGAAAGTTGCGCTCTAAAGGTAGCTTTGGAGACGACTTCA AGGTGAGCGAGGCCCTAATACTGTTCTCCTTAGCCGGGGACGTTAAAGGCCTTATAGACCAGTTCCCCCCGGGGGAGGGC ATAGGCTGGGTTCGGAAGAGGTTCGGCCTTGAAATATCCCCAGAGAACATAGAGAGGGTCTTCAACACCTTCTACCTCGG AAACATCTACGAGGACAGGCTCTTCGACTTTCCGGGCCTCTGGAGGAGGGAGAAACCGCTCATCGAGGCCGAGCTCTTAA GGAAACTTTCAGAGGAGTTCAAGGTTGGGGTCGTCACAGGCAGGAGCGAGCTTGAGCTCAGGCTGGCTGAAGAAATCCTC GGCTTCCGCTTTGAAAGGGCC