

>tg1623 Type III restriction endonuclease, res subunit

>tg1623 Type III restriction endonuclease, res subunit

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1524556 - 1528855 (Additional range around tg1623 is :500nt.)

>Thermococcus gammatolerans EJ3 CAATGAAAGTGAGCCCATCAACAATCGCACGAACACTGAAGAAACTACGTGAGCAGGGAGTCATCGAGGAACGGAGAGTA GTCAAAGTAAACAAGAAGAAACTGAAAGAGGTGATAGACAATGCAAGATAACTACGAAGAGCGCATAGCTGAGCTCGAAC GCGAGATAGAAAAGCTCAAGCGAGAGCTGAACAAACTCAAAACTGGACAGGAATGGTATGAGAACGAACTCGAAGATCAA AACAAGAGAATAACCATCATAGAACGAATCCTTGATGTTTACTACGATAGCGAAGCTTCAAAATGGCAAAGCAGGTACCT CAAGCGTATCTATGCTACGCTCAAAAAGCTTGAGCGAAAGCTTGAGCAGAAGAAAAATACAACCACGCAAAAGCAACTGC CCACCTGAGTAGCTCAGCGTGTCTCCAGCATGTACTCGATGTAATATACTCGATACGATGCATAACCTTTTTATCCAGCC AGATAGAAAGACCCCCTTGG ttgagggtaatggtgggaactttgaaacccggctacatcctcaagagcacgaaatggaa ggagccttttctcgtcgagatcgtgaacgaaagtggagacaccatcatggtgggaggccactacctgaactcccgcaagg ccgacctctacatactgacgaaagccgaccttgaggagattgaaatcatcacaaaccctcttgacttcaaaggagaccca gaagcagctgccctcgcaatcgagggagaacggtaccatttcgcctcactctatgacccaatactcgcggtcagcgtctc gaaaatagcacccctccccttccagatcgacgcggtctacaaccacatcctcagaaaccccgagatacgcttcctccttg cggacgaccccggtgccggaaaaaccatcatggcaggccttgtgataaaagagctcaaactcagaggcttggccgagaga atcctcatagtcgttcccggccatcttgtaccccagtggaagagggagatgaaagagaagttccaggaagagttcacaat tgtcaacagagagattttccggacgacaaccgacgtttggagacgtgaaaaacaggtaattgcctcaatagacttcctca aacaagaagacatcctcaagagccttgagaatgttgattgggaccttgtgatagtggatgaagcccataagatggccgcg tatcgcttcgggaagaagatctaccgcacgaagaggtacaaagtgggtgaggtgctctcaaggaactccacccacatgct cttcctcactgccacgccccacaagggagacccggaaaacttccgtctccttcttgacctccttgttccgggccttttca gcgacaaagaaatactccttgaggcaataaggagaaacgagaaccccatattcctcagacgtatgaaagaagacctcgtg gactttgaggggaagaagatattcaagcccaggtactcccacacggtgaacttcaacctcaccgacaaggagatcaagct ctacaacgagctctcccgctacatccactaccagtacaccgttctcgaagggagcaggcggagcatagtcttcccgctcg tgatactccagaggaggttcgcatcgagcacgtacgcacttctccagtccctcaggcgcagaaaagcacgcctcaaggaa taccttgagagcgggaagcttgaaaccaagggcgtgcaactcgactttgaggacctccttgagctcgaggacgaagagga aagggaaaggtggaaggccgagctgaggctcgaaggcctccccatagtgaggaagaggaagctcatagaagccgagataa gaacccttgacgagctcataaggatgagcgaagagctgatagcatcggaggaagagacgaagctcaagaagctcagagag acgctggacttcatagcgagagaacacggcgagaaagagaagatcctcatcttcacggagttcaaggacacccttgagta cctcgtgaacaagctccaggagtggggctacacggttaccttcatccacggcgagatggacatggagacgaggctccaac gcgaaaaggacttcagggagtgggctcaggtcatggttgccaccgaggcggccggagagggcataaacctccagttctgt catctgctcataaactacgacatcccgtggaaccccaacaggcttgaacagaggataggaagggtgcaccgctacggtca gaggtatccggttcacatcttcaacttcgtggccagaaacacgagggagggcatggtactcgagaggctcctccacaaga tagaggagataaggaaagccctcggggataaggtcttcgacgttatcggagaactcctcgatggggagaatctgtacacc ctcctcgcagaggtcgccgtcatgctcagagacccggacagcgtcctgaaggaggaagagccaaagttccagcctgaaga aatcacgaagaaggcggaagagctcctcggggagagcctcgcgacgaagcacatagacctgagcaggataatgcggcttc tcgaaaaggccgaagagaaccggctatcgccagagtacctcgaactattcttcctcaaagccatgaagcgcctcaacgcg agaataagggagaaagagccacacgtttattcgattgagagaacccccagagtcctgagggagatagccgaaagaaaggg ctacggcacggtggagcgttcgtacagggccataacctttgacaaagcaatctctgaggagagggacgacgtggagttcg tctcgtttggacatccgctcttcgaagccctccgcgagtgggttcaggaggaatatctcaaagagctccagcgcggggcg gtcttctacgaccccaggaacagactccacggcaccatctggttcttcgagggtgaagtccaggacggcttcaacaagac ggcaggcaagacgctcgtggcggtctacgacgatggcgagaaccttgaggtcatagacccgaagataatatgggacctcg aaccggccaaagattctccagaggtggaggttgagttcagccggagagagaacgcgatgatttacgccatgaaggccctc gaagagtacagggacaggcttctcagggagaggaagaggcaggcggagataaaggagaagtacggagtgaagtccctcaa gaagctgatagacgacctcgactacaagctggccgagtacgaactcctcccgccggaagagaagaagaggtacgcactca ccataaggaaccttgaggagaggctgaaccgttatcggaaggcgctgaaggaactgccggaaaagatagccagggagacg agcctcatggtgaggcctcccgtcttcatcggggccatctacgtgctcccgaggggagggatgggagaagacccggcaat agaagagataggaatgcagatagccatgcagtacgagagagagcagggaagaaaccccgtagacgtctcgaaggagaacc tcggctacgacatctactccgagggcaacggtgagaagaggtacatagaggtaaaggcgagagcccacctcggggacgtt gagctcacatggaacgagtacgttaccgcgaagaggctccgcgacaagtactggctctacgttgtcgcatacgccgccga gaagccgaccctctacatcatccgtgatcccgctcacaccctcaaggtcgtggagaagtacgagataaggttcaaagtcc cggttgaggagtggaaaaagaagggtaagaaggttgaagtc TGAGGAGGCGGTAGAATGGAGGACAAGCGCTTTATTGA GGTTGCCTTCCCGGTCAAGGCCGTAAGTGAAGAGTCCGCAAGGGAGAAGAACATAAGGCACGGCCACATCTCTACCCTGC ACATCTGGTGGGCAAGGCGCCCGCTGGCTTCTTCCCGCGCGACCAACTACGCCGCACTCATCCCAGCTCCAAAGGATGAG GAAGAGCTCGAACGGAAGAAGAGGTTCATAGCAAAGCTCTCGAAGTGGGAAAGTTCACTCGACGAAGAAATCATAAGAAG GGCCCGCGAGGACATCATGGAGTACTTCAGGGGGATACGCGACGACCCGAACCAGGAAAGGCCCCGCGTCCTCGACCCCT TCGCGGGGGGAGGCTCGATACCGCTTGAGGCCCTTCGCCTCGGCTGTGAGACGTACGCGGTGGACTACAATCCAGTTGCA GTTCTCATCCTCAAGGCAGTCCTTGAGTATCCGCAGAAGTACGGGAAAAAGAAGAAGGGAG