

>tg1629 hypothetical protein TGAM_1629

>tg1629 hypothetical protein TGAM_1629

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1536094 - 1539100 (Additional range around tg1629 is :500nt.)

>Thermococcus gammatolerans EJ3 AGTTTTTATATAGTGTGCGCACACATAGTGTTGAGGTGAAATCAGATGGGTAGGTACAACCTATACATACCTGCCTCCAC AAAGTACCTTCTCAGAAGAGCTTCAAAGAGACTACTCACCACCCAGATAGAGCTGGCCCGTAAAATCGCTGATGGAAAGG TTGATTTTGACGACATATACACCTGGGGCCTTGATTTGAGGGATAGAGAGAGGATAAGATTCCTCTACGAGACTGAGAAA GAATTCGCCTTCAAGGCCGTTTTTCCCGTGCGTACGGAGAACCCCAGTGAGGTAAGGGCCAGTATTCTGGCCGTAAGTGA GATGGTTGAGAGGATCGTAAAGAAGTTTTACCAGGACCATGAAGACCTCCACGAGGCTATCGGAAGTGTTCATACCGCCC TCTGGAGAATACAGCACACCGACGGACTCACAGAATGGGACAAGAAGCGCCTTGCAAGGCACGTAGAAGAGATTCAAAAG CTTCTCAGGGGTGATGAACA atgatgccgaggcacgtcagccttatcagcgacgaagacagggcaatcctcgaaaacaa ggaggctctttctggcatgatacggaagtacttggagtttctctatgagaacacgaagcaagagtactggttcgaggtga gaattcttgggttggatggaagcgtaaagcgtaggatgttcagaatcaaggacattggaagggctacgaattacatcatc agagaaatgaactctgacagcagaataaagggcatatacgtcacgataaacccggctggaggtcagaaaggaggttcctt tacgaacgatgacatacttgaagtgataaacctgccaattgatgtggatgtcttccacaatagggccccatcagaggttg aggtatcagcagtgaagggagcgataaagagagccatccaggaactgttcgggaagtacaacttcagatacatggtggtt ttctcgggctttggcttccatgtgtacctcaaggtgaatcccgttgaggttggtgacagaaattggcaggcggcttttcg ggaggttggaagagaactcgcagacgagtttgagagggtgctcaaagagagcatagacccaaactactcccatctcgttg aggatgccgtggataagagcgtgtacaacccttcacgcattatgagggttgcctggactgtgaacaggcgaaagataggt ggaacaatctacgaggccgtttcaaagatagttgaaatctccggagcgaacaggcttgaaattgatgaactcgtcaagaa aaagctccgagaaggtattacaacgcgggaagagctccacattgagaatatgggtggtacaaggctcaacagtgaggaga aagacgccttggtcgaagccctgaaaaagtactacatgccgggtaggagacacaacctcgtcctcggatttgccgccttt gcctggcacaaagggattcgagtggaagacacactcgaggttgtgagaagagtgtacgttgagaccggggatagtgaccc ttgggaggaccgggagagagcagttctggacacgtactcagcaacactgaagaactacaggagctacctggggaaaggaa ctatctgggaactcaacagggcactccgctcatactaccagcgagcaatggtaaaaaagaaggaggaaccaagtgagtac tccgtaacaagtgctcaaaaggttctctccaatgattttgaccttcttgagtggcttatcgagcgtacctccgatataat caaagaggtggacgaaaagagtggcagggtaacctataaagtctcgtttgtcgttgaaagagcaggaaaagtagagacaa tcgttctcaagaacacggagaggacagaaaaggagaagatgttctatgctctcaacgaggactttatggcccactttggg gtttacatagttgacccgctttcaatcaggaagctcaacaggcaggaaaggagtaagttcaatgacgttctcgccaagat aatgctggattactacgcattcgttacaagaaacgcgaaggagattgtaatagaggagtacgaagatgtcaagaacattt tcctggatatcatcgagaccgaggtccttgagatagtgaaaattgacgagttgaattcaataagcggagaccgtgtcgac gagctattccggaagaggataatgatctacgctgaaaacgagaacagagtctactttgacccccatcttctcgagtatgg ggctgagacccgtggattcgcgcgaactctcgccaagttcctccacagaattggggtcattgacaagaaaacctggagag aagtcagacggagcaagtctttgaggaatgggagacacgtgtatctctattacctgatttcagacagattctttgacttc cttgagaaagagaacgccataaagccccccataaagaccattgatgagtacttggatgaacaggagtacgtggatcttga tgagattgcaggggagagtgttgcggcg TGAACGCCCAGATAACCATTCTGGGGCCTCCAGGGACGGGAAAGACCTCTG CTCTCATCAATCTCTACAAATACTTTATCGGAGACGCTTCCACGGATGTTACAAGCTTCGTGCAACGATACGGTCTCAAT AAGCTCATCACGAGAAGGGATTACACGAGCGATGAGGTTCTCTTTCTTACCTTTACAACTTCCGCGGTCAGGGTTCTGAA AGAAAGAGGAATTTACAACGCGTACACTCTGCACAGTTACATCACAAGGGTTCTTATGCGGAATAAACTCCTCACACCAG CAGGATTCATGAGAGAGCCGTTTATTGCCGCGATGATGGAAATGAACTATGGCTATGACTTCAGGGATCGGTTCAGTTCA CACCCGTCAAACGTTGCCGAGATAAGGTACAACTACTATTTCAACGTCTATTATGATAAAACCAGCAAGGAAATTCTCGA AATTGTAAAACAACAGGAGAAAGACGCCGTGTACCAGAGAATAAGGGA