

>tg1652 GHMP kinase (ghmP)

>tg1652 GHMP kinase (ghmP)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1557872 - 1559837 (Additional range around tg1652 is :500nt.)

>Thermococcus gammatolerans EJ3 AGCGGTGCAATAGCCCTCGGTATTCTAACGGCCTTCGTTGAGCTCCTTCCCTTCCTCGGTGGCTGGCTCATCTGGATCCC CGGTGTGGTCTACCTCATTCACTCTTCCAACTACGTTCTAGCGTTCCTCTTCGCCGTTTACTCCATAGTTTTCGTATCCC CCCTACCGGACTTCGTGCTGGCCCCCAAGATGACCCTGAGGAGGCGTGGACTGAACGCCCTCATCTCCCTTCTCGGAATC TTCGGTGGCCTCTGGGCCTTCGGACTCGTCGGAATAATAATAGGACCCGTCTCCCTCGGTCTGCTGGCGACGGTTATTGA GGAATGGAAAAAAGCGATGGAGAGCCAACCGGCCGAATAAATGGCGACCCTATAGCATCGAGCGCCTCCTCCACGTCTTT TTGGTTCCGATGATGCCCACTCACCCAAGAGAAGATTTTCCGCAAACTTCATTAGCACCACTGCCAAGACCCATCAGGAG CCAACAAACGGGTGAGAGGC atgataatccggacgccgaagaggcttcacctcggcctgatagacccaacgggctcgct cggaaggcgcttcggaagcctcggggtggcgcttgagggcggctacgatgtcaaggttcttccagcggaaaggcttgagg tgagggctgaaggggaagacgtagagacgataaagaaggctgttgagaagatgaactcgacctttggaaccggaaccggc tacctgattgaggtgcggaagaccattccgaggcacgttggtctcggctcaacgacccagctgagcttggccgttggaac cgcaatagcgaggctcaacaacctgagcgtttcgattgaggggctcgccgaggccctcggaaggggaaagaacagcgggg ccgggatttacgccttcgcttacggtggtttcgtcctcgacggcggagtcaagaagggagtcccaccacttataatccgt gaagactttccggaggagtgggcgttcctgctcgtgattccagagctcaggccgggcctcgacgaagaggaggaaaagcc gataatgggcggaaacttcgggagcgctgaagtggccagggagataagccaccgcattttactcggcctcctgccagcgc taaaggagaggaacataaaagccttcggagagcacctctccgcaatacagaggctcgtgggcaggcacttcgcggagttc cagggcggtgagttcaggggggacgttaagctaattctcgactggctgggtgagaaaacatacggcgcaggccagagcag ctgggggccgaccgtttacggcctaatcctgaaaggggagttccagaggctctcggcggagctgagtgactatctacggg agcacgggataaaagctaaagtcgaactctgccttccgaggaacacgggagcagaggttgtaagcgagaacgccttcctg gaaaggttgataaggagcgtggcgcaa TGACGCTCGACCGCTTCGTGAGAATAAAATACAGAGAGGACAATGAGAAAGT CAACAGGCTCGTGGAAATACTGCGGGAGCTCGGCCTTGACTGCGCGAGAACCATTGAGGAGAAAGTCGATTTGCAGTTCG ATGCACTGAGAAACCTTCGGGAGAACCTGAAGGACGACGAACTCTTCATCAAGCTCGTCATAGCCAACGCCCTCGTCAGC TACCAGCTGAGCGGGAAAGGCGAGGACTGGTGGTGGGAGTTTTCAAGGTATTTCTCGGAGAACCCGCCCGAGGACATAGT GGAGGCCTACTCTTCGTTTCTCCCAAACTCAAAGACAAACAGGCGTCTCGTTGCGGGGAAGCTTAAAAGAATCGAGAGGG TCGAGCCGTTCCTGAGCCCTCTCTCGATAAGCGAGATTAGAGACTACTACTTCAACGGCATGGAAAGGCTGAGAGATGAG CTTGCAAGGGTTATGAAGGCTAAAAGGAGCGCGAAAACGATAGTCTT